Database STAT3base
Version 1.1
File stat3pub.html
Date 16-Jun-2011
Curator Mauno Vihinen
Address Protein Structure and Bioinformatics
Address Lund University, BMC D10, SE-22184 Lund, Sweden
Phone +46 72 526 0022
Fax +46 46 222 9328
Email Mauno Vihinen
URL http://structure.bmc.lu.se/idbase/STAT3base/
IDR factfile http://structure.bmc.lu.se/idbase/IDRefSeq/xml/idr/ff/FF75.html
Gene STAT3
Disease Hyper-IgE syndrome
OMIM 102582
Sequence IDRefSeq:D0128; IDRefSeq:C0128; UniProt:P40763
Numbering start of the entry
Funding Tampere University Hospital Medical Research Fund
Funding European Union
Comments sequence entry reference in every entry
//
ID H332Y(1a); standard; MUTATION; DNA-binding
Accession S0065
Systematic name g.53280C>T, c.994C>T, r.994c>u, p.His332Tyr
Original code C1
Description A point mutation in the exon 9 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18706697
RefAuthors Jiao, H., Toth, B., Erdos, M., Fransson, I., Rakoczi, E.,
RefAuthors Balogh, I., Magyarics, Z., Derfalvi, B., Csorba, G.,
RefAuthors Szaflarska, A., Megarbane, A., Akatcherian, C., Dbaibo,
RefAuthors G., Rajnavolgyi, E., Hammarstrom, L., Kere, J., Lefranc,
RefAuthors G., Marodi, L.
RefTitle Novel and recurrent STAT3 mutations in hyper-igE syndrome
RefTitle patients from different ethnic groups.
RefLoc Mol Immunol:202-206 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 53280
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1234
Feature /codon: cat -> tat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 332
Feature /change: H -> Y
Feature /domain: DNA-binding
Symptoms Severe eczema; Cold abscess; Candidiasis; Pneumonia;
Symptoms Bronchiectasis; Scoliosis; Pathologic fracture;
Symptoms Face of job
Age 24
Sex XX
Ethnic origin Hungary
Relative STAT3base; S0066 son
Relative STAT3base; S0067 son
//
ID H332Y(1b); standard; MUTATION; DNA-binding
Accession S0066
Systematic name g.53280C>T, c.994C>T, r.994c>u, p.His332Tyr
Original code C2
Description A point mutation in the exon 9 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18706697
RefAuthors Jiao, H., Toth, B., Erdos, M., Fransson, I., Rakoczi, E.,
RefAuthors Balogh, I., Magyarics, Z., Derfalvi, B., Csorba, G.,
RefAuthors Szaflarska, A., Megarbane, A., Akatcherian, C., Dbaibo,
RefAuthors G., Rajnavolgyi, E., Hammarstrom, L., Kere, J., Lefranc,
RefAuthors G., Marodi, L.
RefTitle Novel and recurrent STAT3 mutations in hyper-igE syndrome
RefTitle patients from different ethnic groups.
RefLoc Mol Immunol:202-206 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 53280
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1234
Feature /codon: cat -> tat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 332
Feature /change: H -> Y
Feature /domain: DNA-binding
Symptoms Severe eczema; Cold abscess; Pneumonia; Face of job
Age 5
Sex XY
Ethnic origin Hungary
Family history Inherited
Relative STAT3base; S0065 mother
Relative STAT3base; S0067 brother
//
ID H332Y(1c); standard; MUTATION; DNA-binding
Accession S0067
Systematic name g.53280C>T, c.994C>T, r.994c>u, p.His332Tyr
Original code C3
Description A point mutation in the exon 9 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18706697
RefAuthors Jiao, H., Toth, B., Erdos, M., Fransson, I., Rakoczi, E.,
RefAuthors Balogh, I., Magyarics, Z., Derfalvi, B., Csorba, G.,
RefAuthors Szaflarska, A., Megarbane, A., Akatcherian, C., Dbaibo,
RefAuthors G., Rajnavolgyi, E., Hammarstrom, L., Kere, J., Lefranc,
RefAuthors G., Marodi, L.
RefTitle Novel and recurrent STAT3 mutations in hyper-igE syndrome
RefTitle patients from different ethnic groups.
RefLoc Mol Immunol:202-206 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 53280
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1234
Feature /codon: cat -> tat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 332
Feature /change: H -> Y
Feature /domain: DNA-binding
Symptoms Severe eczema; Pyoderma; Pneumonia; Face of job
Age 3
Sex XY
Ethnic origin Hungary
Family history Inherited
Relative STAT3base; S0065 mother
Relative STAT3base; S0066 brother
//
ID G342D(1); standard; MUTATION; DNA-binding
Accession S0089
Systematic name g.53311G>A, c.1025G>A, r.1025g>a, p.Gly342Asp
Description A point mutation in the exon 9 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20149460
RefAuthors Papanastasiou, A. D., Mantagos, S., Papanastasiou, D. A.,
RefAuthors Zarkadis, I. K.
RefTitle A novel mutation in the signal transducer and activator of
RefTitle transcription 3 (STAT3) gene, in hyper-igE syndrome.
RefLoc Mol Immunol:1629-1634 (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 53311
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1265
Feature /codon: ggc -> gac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 342
Feature /change: G -> D
Feature /domain: DNA-binding
Symptoms Fever; Cough; Dermatitis; Skin abscesses; Pneumonia;
Symptoms Scoliosis
Age 12
Sex XX
Ethnic origin Greece
//
ID R382G(1a); standard; MUTATION; DNA-binding
Accession S0087
Systematic name g.57365C>G, c.1144C>G, r.1144c>g, p.Arg382Gly
Original code 6-1
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20093388
RefAuthors Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine,
RefAuthors N. H., Leppert, M. F., Carey, J. C., Ochs, H. D.,
RefAuthors Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle Rapid molecular analysis of the STAT3 gene in job syndrome
RefTitle of hyper-igE and recurrent infectious diseases.
RefLoc J Mol Diagn:213-219 (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57365
Feature /change: c -> g
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature /codon: cgg -> ggg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> G
Feature /domain: DNA-binding
Symptoms Eczema; Abscess; Pneumonia; Candidiasis
IgE 21,700 IU/ml
Sex XX
Family history De novo
Relative STAT3base; S0088 unknown
//
ID R382G(1b); standard; MUTATION; DNA-binding
Accession S0088
Systematic name g.57365C>G, c.1144C>G, r.1144c>g, p.Arg382Gly
Original code 6-2
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20093388
RefAuthors Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine,
RefAuthors N. H., Leppert, M. F., Carey, J. C., Ochs, H. D.,
RefAuthors Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle Rapid molecular analysis of the STAT3 gene in job syndrome
RefTitle of hyper-igE and recurrent infectious diseases.
RefLoc J Mol Diagn:213-219 (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57365
Feature /change: c -> g
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature /codon: cgg -> ggg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> G
Feature /domain: DNA-binding
Symptoms Eczema; Abscess; Pneumonia; Candidiasis
IgE 334 IU/ml
Sex XY
Family history Inherited
Relative STAT3base; S0087 unknown
//
ID R382L(1); standard; MUTATION; DNA-binding
Accession S0052
Systematic name g.57366G>T, c.1145G>T, r.1145g>u, p.Arg382Leu
Original code Family J088; Proband
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57366
Feature /change: g -> t
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature /codon: cgg -> ctg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> L
Feature /domain: DNA-binding
Ethnic origin White-Hispanic
Family history Sporadic
//
ID R382Q(1); standard; MUTATION; DNA-binding
Accession S0008
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code Patient 4
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Sep-2007 (Rel. 1, Created)
Date 13-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17676033
RefAuthors Minegishi, Y., Saito, M., Tsuchiya, S., Tsuge, I., Takada,
RefAuthors H., Hara, T., Kawamura, N., Ariga, T., Pasic, S.,
RefAuthors Stojkovic, O., Metin, A., Karasuyama, H.
RefTitle Dominant-negative mutations in the DNA-binding domain of
RefTitle STAT3 cause hyper-igE syndrome.
RefLoc Nature:1058-1062 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57366
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> Q
Feature /domain: DNA-binding
Age 10
Sex XY
Family history De novo
//
ID R382Q(2); standard; MUTATION; DNA-binding
Accession S0018
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code Family J008; Proband
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57366
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> Q
Feature /domain: DNA-binding
Ethnic origin Caucasoid
Family history De novo
//
ID R382Q(3a); standard; MUTATION; DNA-binding
Accession S0030
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code Family J017; Proband
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57366
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> Q
Feature /domain: DNA-binding
Ethnic origin Caucasoid
Family history Inherited
Relative STAT3base; S0031 father
Relative STAT3base; S0032 brother
//
ID R382Q(3b); standard; MUTATION; DNA-binding
Accession S0031
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code Family J017; Father
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57366
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature /codon: cgg -> cag; 2
Feature /note: mosaic
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> Q
Feature /domain: DNA-binding
Sex XY
Ethnic origin Caucasoid
Family history Sporadic
Relative STAT3base; S0030 child
Relative STAT3base; S0032 son
//
ID R382Q(3c); standard; MUTATION; DNA-binding
Accession S0032
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code Family J017; Brother
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57366
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> Q
Feature /domain: DNA-binding
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative STAT3base; S0030 sibling
Relative STAT3base; S0031 father
//
ID R382Q(4); standard; MUTATION; DNA-binding
Accession S0034
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code Family J021; Proband
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57366
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> Q
Feature /domain: DNA-binding
Ethnic origin Negroid
Family history Sporadic
//
ID R382Q(5); standard; MUTATION; DNA-binding
Accession S0039
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code Family J030; Proband
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57366
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> Q
Feature /domain: DNA-binding
Ethnic origin Negroid
Family history De novo
//
ID R382Q(6); standard; MUTATION; DNA-binding
Accession S0057
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code Family J113; Proband
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57366
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> Q
Feature /domain: DNA-binding
Ethnic origin Caucasoid
Family history Sporadic
//
ID R382Q(7); standard; MUTATION; DNA-binding
Accession S0061
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code HIES2
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18591410
RefAuthors Ma, C. S., Chew, G. Y., Simpson, N., Priyadarshi, A.,
RefAuthors Wong, M., Grimbacher, B., Fulcher, D. A., Tangye, S. G.,
RefAuthors Cook, M. C.
RefTitle Deficiency of th17 cells in hyper igE syndrome due to
RefTitle mutations in STAT3.
RefLoc J Exp Med:1551-1557 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57366
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> Q
Feature /domain: DNA-binding
Symptoms Staphylococcus aureus pneumonia and abscesses; fractures;
Symptoms parenchymal lung damage; retained primary teeth
Age 18
Sex XY
//
ID R382Q(8); standard; MUTATION; DNA-binding
Accession S0062
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code HIES3
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18591410
RefAuthors Ma, C. S., Chew, G. Y., Simpson, N., Priyadarshi, A.,
RefAuthors Wong, M., Grimbacher, B., Fulcher, D. A., Tangye, S. G.,
RefAuthors Cook, M. C.
RefTitle Deficiency of th17 cells in hyper igE syndrome due to
RefTitle mutations in STAT3.
RefLoc J Exp Med:1551-1557 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57366
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> Q
Feature /domain: DNA-binding
Symptoms Staphylococcus aureus abscesses; Fractures;
Symptoms Retained primary teeth; candidiasis
Age 15
Sex XY
//
ID R382Q(9a); standard; MUTATION; DNA-binding
Accession S0076
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code 1-1
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20093388
RefAuthors Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine,
RefAuthors N. H., Leppert, M. F., Carey, J. C., Ochs, H. D.,
RefAuthors Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle Rapid molecular analysis of the STAT3 gene in job syndrome
RefTitle of hyper-igE and recurrent infectious diseases.
RefLoc J Mol Diagn:213-219 (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57366
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> Q
Feature /domain: DNA-binding
Symptoms Eczema; Abscess; Pneumonia; Candidiasis
IgE 4,000 IU/ml
Sex XY
Family history De novo
Relative STAT3base; S0077 unknown
Relative STAT3base; S0078 unknown
//
ID R382Q(9b); standard; MUTATION; DNA-binding
Accession S0077
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code 1-2
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20093388
RefAuthors Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine,
RefAuthors N. H., Leppert, M. F., Carey, J. C., Ochs, H. D.,
RefAuthors Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle Rapid molecular analysis of the STAT3 gene in job syndrome
RefTitle of hyper-igE and recurrent infectious diseases.
RefLoc J Mol Diagn:213-219 (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57366
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> Q
Feature /domain: DNA-binding
Symptoms Eczema; Abscess; Pneumonia; Candidiasis
IgE 98,766 IU/ml
Sex XX
Family history Inherited
Relative STAT3base; S0076 unknown
Relative STAT3base; S0078 unknown
//
ID R382Q(9c); standard; MUTATION; DNA-binding
Accession S0078
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code 1-3
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20093388
RefAuthors Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine,
RefAuthors N. H., Leppert, M. F., Carey, J. C., Ochs, H. D.,
RefAuthors Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle Rapid molecular analysis of the STAT3 gene in job syndrome
RefTitle of hyper-igE and recurrent infectious diseases.
RefLoc J Mol Diagn:213-219 (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57366
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> Q
Feature /domain: DNA-binding
Symptoms Eczema; Abscess; Pneumonia; Candidiasis
IgE 16,172 IU/ml
Sex XX
Family history Inherited
Relative STAT3base; S0076 unknown
Relative STAT3base; S0077 unknown
//
ID R382Q(10); standard; MUTATION; DNA-binding
Accession S0079
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code 2-1
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20093388
RefAuthors Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine,
RefAuthors N. H., Leppert, M. F., Carey, J. C., Ochs, H. D.,
RefAuthors Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle Rapid molecular analysis of the STAT3 gene in job syndrome
RefTitle of hyper-igE and recurrent infectious diseases.
RefLoc J Mol Diagn:213-219 (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57366
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> Q
Feature /domain: DNA-binding
Symptoms Eczema; Abscess; Pneumonia; Candidiasis
IgE 1451 IU/ml
Sex XY
Family history Not known
//
ID R382Q(11a); standard; MUTATION; DNA-binding
Accession S0080
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code 10-1
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20093388
RefAuthors Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine,
RefAuthors N. H., Leppert, M. F., Carey, J. C., Ochs, H. D.,
RefAuthors Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle Rapid molecular analysis of the STAT3 gene in job syndrome
RefTitle of hyper-igE and recurrent infectious diseases.
RefLoc J Mol Diagn:213-219 (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57366
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> Q
Feature /domain: DNA-binding
Symptoms Eczema; Abscess; Pneumonia; Candidiasis
IgE 15,776 IU/ml
Sex XX
Family history Not known
Relative STAT3base; S0081 unknown
//
ID R382Q(11b); standard; MUTATION; DNA-binding
Accession S0081
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code 10-2
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20093388
RefAuthors Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine,
RefAuthors N. H., Leppert, M. F., Carey, J. C., Ochs, H. D.,
RefAuthors Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle Rapid molecular analysis of the STAT3 gene in job syndrome
RefTitle of hyper-igE and recurrent infectious diseases.
RefLoc J Mol Diagn:213-219 (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57366
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> Q
Feature /domain: DNA-binding
Symptoms Eczema; Abscess; Pneumonia; Candidiasis
IgE 40,009 IU/ml
Sex XX
Family history Not known
Relative STAT3base; S0080 unknown
//
ID R382W(1); standard; MUTATION; DNA-binding
Accession S0001
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code Patient 2
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Sep-2007 (Rel. 1, Created)
Date 13-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17676033
RefAuthors Minegishi, Y., Saito, M., Tsuchiya, S., Tsuge, I., Takada,
RefAuthors H., Hara, T., Kawamura, N., Ariga, T., Pasic, S.,
RefAuthors Stojkovic, O., Metin, A., Karasuyama, H.
RefTitle Dominant-negative mutations in the DNA-binding domain of
RefTitle STAT3 cause hyper-igE syndrome.
RefLoc Nature:1058-1062 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57365
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> W
Feature /domain: DNA-binding
Age 9
Sex XX
Family history De novo
//
ID R382W(2); standard; MUTATION; DNA-binding
Accession S0002
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code Patient 7
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Sep-2007 (Rel. 1, Created)
Date 13-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17676033
RefAuthors Minegishi, Y., Saito, M., Tsuchiya, S., Tsuge, I., Takada,
RefAuthors H., Hara, T., Kawamura, N., Ariga, T., Pasic, S.,
RefAuthors Stojkovic, O., Metin, A., Karasuyama, H.
RefTitle Dominant-negative mutations in the DNA-binding domain of
RefTitle STAT3 cause hyper-igE syndrome.
RefLoc Nature:1058-1062 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57365
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> W
Feature /domain: DNA-binding
Age 7
Sex XY
Family history De novo
//
ID R382W(3a); standard; MUTATION; DNA-binding
Accession S0009
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code Family J001; Proband
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57365
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> W
Feature /domain: DNA-binding
Sex XX
Ethnic origin Caucasoid
Family history Sporadic
Relative STAT3base; S0010 daughter
//
ID R382W(3b); standard; MUTATION; DNA-binding
Accession S0010
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code Family J001; Daughter
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57365
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> W
Feature /domain: DNA-binding
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative STAT3base; S0009 mother
//
ID R382W(4); standard; MUTATION; DNA-binding
Accession S0013
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code Family J004; proband
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57365
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> W
Feature /domain: DNA-binding
Ethnic origin Caucasoid
Family history Sporadic
//
ID R382W(5); standard; MUTATION; DNA-binding
Accession S0014
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code Family J005; proband
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57365
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> W
Feature /domain: DNA-binding
Ethnic origin Caucasoid/Negroid
Family history De novo
//
ID R382W(6); standard; MUTATION; DNA-binding
Accession S0020
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code Family J010; Proband
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57365
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> W
Feature /domain: DNA-binding
Ethnic origin Caucasoid
Family history De novo
//
ID R382W(7); standard; MUTATION; DNA-binding
Accession S0033
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code Family J020; Proband
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57365
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> W
Feature /domain: DNA-binding
Ethnic origin Negroid
Family history Sporadic
//
ID R382W(8); standard; MUTATION; DNA-binding
Accession S0042
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code Family J045; Proband
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57365
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> W
Feature /domain: DNA-binding
Ethnic origin Hispanic
Family history Sporadic
//
ID R382W(9); standard; MUTATION; DNA-binding
Accession S0045
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code Family J068; Proband
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57365
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> W
Feature /domain: DNA-binding
Ethnic origin Caucasoid
Family history Sporadic
//
ID R382W(10); standard; MUTATION; DNA-binding
Accession S0059
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code patient
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 03-Jun-2008 (Rel. 1, Created)
Date 03-Jun-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17942886
RefAuthors Renner, E. D., Torgerson, T. R., Rylaarsdam, S., Anover-
RefAuthors Sombke, S., Golob, K., LaFlam, T., Zhu, Q., Ochs, H. D.
RefTitle STAT3 mutation in the original patient with job's
RefTitle syndrome.
RefLoc N Engl J Med:1667-1668 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57365
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> W
Feature /domain: DNA-binding
Symptoms Eczema, multiple atraumatic fractures, candida infection,
Symptoms recurrent Staphylococcus aureus abscesses, pneumonia with
Symptoms lung abscesses and formation of pneumatoceles
Sex XX
//
ID R382W(11a); standard; MUTATION; DNA-binding
Accession S0068
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code N1
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18706697
RefAuthors Jiao, H., Toth, B., Erdos, M., Fransson, I., Rakoczi, E.,
RefAuthors Balogh, I., Magyarics, Z., Derfalvi, B., Csorba, G.,
RefAuthors Szaflarska, A., Megarbane, A., Akatcherian, C., Dbaibo,
RefAuthors G., Rajnavolgyi, E., Hammarstrom, L., Kere, J., Lefranc,
RefAuthors G., Marodi, L.
RefTitle Novel and recurrent STAT3 mutations in hyper-igE syndrome
RefTitle patients from different ethnic groups.
RefLoc Mol Immunol:202-206 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57365
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> W
Feature /domain: DNA-binding
Symptoms Severe eczema; Pneumatocele; Candidiasis; Cold abscess;
Symptoms Pneumonia; Face of job; Pathologic fracture; Scoliosis;
Symptoms Hyperextensibility
Age 40
Sex XX
Ethnic origin Hungary
Relative STAT3base; S0069 daughter
Comment Nephrectomy was done at 7 years age.
//
ID R382W(11b); standard; MUTATION; DNA-binding
Accession S0069
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code N2
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18706697
RefAuthors Jiao, H., Toth, B., Erdos, M., Fransson, I., Rakoczi, E.,
RefAuthors Balogh, I., Magyarics, Z., Derfalvi, B., Csorba, G.,
RefAuthors Szaflarska, A., Megarbane, A., Akatcherian, C., Dbaibo,
RefAuthors G., Rajnavolgyi, E., Hammarstrom, L., Kere, J., Lefranc,
RefAuthors G., Marodi, L.
RefTitle Novel and recurrent STAT3 mutations in hyper-igE syndrome
RefTitle patients from different ethnic groups.
RefLoc Mol Immunol:202-206 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57365
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> W
Feature /domain: DNA-binding
Symptoms Mild eczema; Newborn rash; Cold abscess; Pneumonia;
Symptoms Face of job; Hyperextensibility
Age 8
Sex XX
Ethnic origin Hungary
Family history Inherited
Relative STAT3base; S0068 mother
//
ID R382W(12); standard; MUTATION; DNA-binding
Accession S0070
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code K
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18706697
RefAuthors Jiao, H., Toth, B., Erdos, M., Fransson, I., Rakoczi, E.,
RefAuthors Balogh, I., Magyarics, Z., Derfalvi, B., Csorba, G.,
RefAuthors Szaflarska, A., Megarbane, A., Akatcherian, C., Dbaibo,
RefAuthors G., Rajnavolgyi, E., Hammarstrom, L., Kere, J., Lefranc,
RefAuthors G., Marodi, L.
RefTitle Novel and recurrent STAT3 mutations in hyper-igE syndrome
RefTitle patients from different ethnic groups.
RefLoc Mol Immunol:202-206 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57365
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> W
Feature /domain: DNA-binding
Symptoms Moderate eczema; Newborn rash; Cold abscess;
Symptoms Oral candidiasis; Pneumonia; Face of job; Hyperextensibility
Age 5
Sex XY
Ethnic origin Hungary
//
ID R382W(13); standard; MUTATION; DNA-binding
Accession S0071
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code S1
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18706697
RefAuthors Jiao, H., Toth, B., Erdos, M., Fransson, I., Rakoczi, E.,
RefAuthors Balogh, I., Magyarics, Z., Derfalvi, B., Csorba, G.,
RefAuthors Szaflarska, A., Megarbane, A., Akatcherian, C., Dbaibo,
RefAuthors G., Rajnavolgyi, E., Hammarstrom, L., Kere, J., Lefranc,
RefAuthors G., Marodi, L.
RefTitle Novel and recurrent STAT3 mutations in hyper-igE syndrome
RefTitle patients from different ethnic groups.
RefLoc Mol Immunol:202-206 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57365
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> W
Feature /domain: DNA-binding
Symptoms Severe eczema; Skin abscess; Oral candidiasis; Sinusitis;
Symptoms Otitis; Pneumonia; Face of job; Hyperextensibility
Age 9
Sex XY
Ethnic origin Hungary
//
ID R382W(14); standard; MUTATION; DNA-binding
Accession S0072
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code SW
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18706697
RefAuthors Jiao, H., Toth, B., Erdos, M., Fransson, I., Rakoczi, E.,
RefAuthors Balogh, I., Magyarics, Z., Derfalvi, B., Csorba, G.,
RefAuthors Szaflarska, A., Megarbane, A., Akatcherian, C., Dbaibo,
RefAuthors G., Rajnavolgyi, E., Hammarstrom, L., Kere, J., Lefranc,
RefAuthors G., Marodi, L.
RefTitle Novel and recurrent STAT3 mutations in hyper-igE syndrome
RefTitle patients from different ethnic groups.
RefLoc Mol Immunol:202-206 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57365
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> W
Feature /domain: DNA-binding
Symptoms Moderate eczema; Skin abscess; Dental infections; Otitis;
Symptoms Pneumonia; Empyema; Bronchiectasis; Osteitis
Age 25
Sex XY
Ethnic origin Sweden
//
ID R382W(15); standard; MUTATION; DNA-binding
Accession S0084
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code 5-1
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20093388
RefAuthors Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine,
RefAuthors N. H., Leppert, M. F., Carey, J. C., Ochs, H. D.,
RefAuthors Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle Rapid molecular analysis of the STAT3 gene in job syndrome
RefTitle of hyper-igE and recurrent infectious diseases.
RefLoc J Mol Diagn:213-219 (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57365
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> W
Feature /domain: DNA-binding
Symptoms Eczema; Abscess; Pneumonia; Candidiasis
IgE 8,000 IU/ml
Sex XY
Family history Not known
//
ID R382W(16); standard; MUTATION; DNA-binding
Accession S0085
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code 8-1
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20093388
RefAuthors Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine,
RefAuthors N. H., Leppert, M. F., Carey, J. C., Ochs, H. D.,
RefAuthors Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle Rapid molecular analysis of the STAT3 gene in job syndrome
RefTitle of hyper-igE and recurrent infectious diseases.
RefLoc J Mol Diagn:213-219 (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57365
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> W
Feature /domain: DNA-binding
Symptoms Eczema; Abscess; Pneumonia; Candidiasis
IgE 29,899 IU/ml
Sex XY
Family history Not known
//
ID R382W(17); standard; MUTATION; DNA-binding
Accession S0086
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code 9-1
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20093388
RefAuthors Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine,
RefAuthors N. H., Leppert, M. F., Carey, J. C., Ochs, H. D.,
RefAuthors Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle Rapid molecular analysis of the STAT3 gene in job syndrome
RefTitle of hyper-igE and recurrent infectious diseases.
RefLoc J Mol Diagn:213-219 (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57365
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature /change: R -> W
Feature /domain: DNA-binding
IgE 38,918 IU/ml
Sex XY
Family history Not known
//
ID F384L(1); standard; MUTATION; DNA-binding
Accession S0024
Systematic name g.57371T>C, c.1150T>C, r.1150u>c, p.Phe384Leu
Original code Family J013; Proband
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57371
Feature /change: t -> c
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1390
Feature /codon: ttt -> ctt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 384
Feature /change: F -> L
Feature /domain: DNA-binding
Ethnic origin Caucasoid
Family history Sporadic
//
ID F384S(1); standard; MUTATION; DNA-binding
Accession S0015
Systematic name g.57372T>C, c.1151T>C, r.1151u>c, p.Phe384Ser
Original code Family J006; proband
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57372
Feature /change: t -> c
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1391
Feature /codon: ttt -> tct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 384
Feature /change: F -> S
Feature /domain: DNA-binding
Ethnic origin Caucasoid
Family history Sporadic
//
ID T389I(1); standard; MUTATION; DNA-binding
Accession S0003
Systematic name g.57387C>T, c.1166C>T, r.1166c>u, p.Thr389Ile
Original code Patient 6
Description A point mutation in the exon 12 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Sep-2007 (Rel. 1, Created)
Date 13-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17676033
RefAuthors Minegishi, Y., Saito, M., Tsuchiya, S., Tsuge, I., Takada,
RefAuthors H., Hara, T., Kawamura, N., Ariga, T., Pasic, S.,
RefAuthors Stojkovic, O., Metin, A., Karasuyama, H.
RefTitle Dominant-negative mutations in the DNA-binding domain of
RefTitle STAT3 cause hyper-igE syndrome.
RefLoc Nature:1058-1062 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57387
Feature /change: c -> t
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1406
Feature /codon: aca -> ata; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 389
Feature /change: T -> I
Feature /domain: DNA-binding
Age 7
Sex XX
Family history De novo
//
ID T412S(1); standard; MUTATION; DNA-binding
Accession S0075
Systematic name g.57551A>T, c.1234A>T, r.1234a>u, p.Thr412Ser
Description A point mutation in the exon 13 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 19483664
RefAuthors Powers, A. E., Bender, J. M., Kumanovics, A., Ampofo, K.,
RefAuthors Augustine, N., Pavia, A. T., Hill, H. R.
RefTitle Coccidioides immitis meningitis in a patient with
RefTitle hyperimmunoglobulin E syndrome due to a novel mutation in
RefTitle signal transducer and activator of transcription.
RefLoc Pediatr Infect Dis J:664-666 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57551
Feature /change: a -> t
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1474
Feature /codon: acc -> tcc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 412
Feature /change: T -> S
Feature /domain: DNA-binding
Symptoms Fever; Myalgias; Staphylococcus aureus infections;
Symptoms Pneumonia; Recurrent sinus infection; Headache
Age 17
Sex XX
Ethnic origin United States
Family history Inherited
Comment Patient's sister had the same mutation.
Comment Patient's father had HIES and died of cryptococcal
Comment meningitis.
//
ID R423Q(1a); standard; MUTATION; DNA-binding
Accession S0016
Systematic name g.57585G>A, c.1268G>A, r.1268g>a, p.Arg423Gln
Original code Family J007; Proband
Description A point mutation in the exon 13 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57585
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1508
Feature /codon: cga -> caa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 423
Feature /change: R -> Q
Feature /domain: DNA-binding
Sex XX
Ethnic origin Caucasoid
Family history Sporadic
Relative STAT3base; S0017 daughter
//
ID R423Q(1b); standard; MUTATION; DNA-binding
Accession S0017
Systematic name g.57585G>A, c.1268G>A, r.1268g>a, p.Arg423Gln
Original code Family J007; Daughter
Description A point mutation in the exon 13 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57585
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1508
Feature /codon: cga -> caa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 423
Feature /change: R -> Q
Feature /domain: DNA-binding
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative STAT3base; S0016 mother
//
ID R423Q(2a); standard; MUTATION; DNA-binding
Accession S0027
Systematic name g.57585G>A, c.1268G>A, r.1268g>a, p.Arg423Gln
Original code Family J016; Proband
Description A point mutation in the exon 13 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57585
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1508
Feature /codon: cga -> caa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 423
Feature /change: R -> Q
Feature /domain: DNA-binding
Sex XY
Ethnic origin Mongoloid
Family history De novo
Relative STAT3base; S0028 son
Relative STAT3base; S0029 daughter
//
ID R423Q(2b); standard; MUTATION; DNA-binding
Accession S0028
Systematic name g.57585G>A, c.1268G>A, r.1268g>a, p.Arg423Gln
Original code Family J016; Son
Description A point mutation in the exon 13 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57585
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1508
Feature /codon: cga -> caa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 423
Feature /change: R -> Q
Feature /domain: DNA-binding
Sex XY
Ethnic origin Mongoloid
Family history Inherited
Relative STAT3base; S0027 father
Relative STAT3base; S0029 sister
//
ID R423Q(2c); standard; MUTATION; DNA-binding
Accession S0029
Systematic name g.57585G>A, c.1268G>A, r.1268g>a, p.Arg423Gln
Original code Family J016; Daughter
Description A point mutation in the exon 13 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 57585
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1508
Feature /codon: cga -> caa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 423
Feature /change: R -> Q
Feature /domain: DNA-binding
Sex XX
Ethnic origin Mongoloid
Family history Inherited
Relative STAT3base; S0027 father
Relative STAT3base; S0028 brother
//
ID V432M(1); standard; MUTATION; DNA-binding
Accession S0060
Systematic name g.60821G>A, c.1294G>A, r.1294g>a, p.Val432Met
Original code HIES1
Description A point mutation in the exon 14 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18591410
RefAuthors Ma, C. S., Chew, G. Y., Simpson, N., Priyadarshi, A.,
RefAuthors Wong, M., Grimbacher, B., Fulcher, D. A., Tangye, S. G.,
RefAuthors Cook, M. C.
RefTitle Deficiency of th17 cells in hyper igE syndrome due to
RefTitle mutations in STAT3.
RefLoc J Exp Med:1551-1557 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 60821
Feature /change: g -> a
Feature /genomic_region: exon; 14
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1534
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 432
Feature /change: V -> M
Feature /domain: DNA-binding
Symptoms Candidiasis; Staphylococcus aureus pneumonia and abscesses;
Symptoms parenchymal lung damage; fractures
Age 18
Sex XY
//
ID H437P(1); standard; MUTATION; DNA-binding
Accession S0063
Systematic name g.60837A>C, c.1310A>C, r.1310a>c, p.His437Pro
Original code HIES4
Description A point mutation in the exon 14 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18591410
RefAuthors Ma, C. S., Chew, G. Y., Simpson, N., Priyadarshi, A.,
RefAuthors Wong, M., Grimbacher, B., Fulcher, D. A., Tangye, S. G.,
RefAuthors Cook, M. C.
RefTitle Deficiency of th17 cells in hyper igE syndrome due to
RefTitle mutations in STAT3.
RefLoc J Exp Med:1551-1557 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 60837
Feature /change: a -> c
Feature /genomic_region: exon; 14
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1550
Feature /codon: cac -> ccc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 437
Feature /change: H -> P
Feature /domain: DNA-binding
Symptoms Staphylococcus aureus abscesses; candidiasis
Age 7
Sex XX
Family history Inherited
//
ID H437P(2); standard; MUTATION; DNA-binding
Accession S0091
Systematic name g.60837A>C, c.1310A>C, r.1310a>c, p.His437Pro
Description A point mutation in the exon 14 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20490271
RefAuthors Xie, L., Hu, X., Li, Y., Zhang, W., Chen, L.
RefTitle Hyper-igE syndrome with STAT3 mutation: a case report in
RefTitle mainland china.
RefLoc Clin Dev Immunol:289873 (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 60837
Feature /change: a -> c
Feature /genomic_region: exon; 14
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1550
Feature /codon: cac -> ccc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 437
Feature /change: H -> P
Feature /domain: DNA-binding
Symptoms Cough; Bloodu sputum; Boils on face and limbs; Eczema;
Symptoms Recurrent pneumonia
IgE 37,700 IU/mL
Age 20
Sex XY
Ethnic origin China
//
ID H437Y(1); standard; MUTATION; DNA-binding
Accession S0004
Systematic name g.60836C>T, c.1309C>T, r.1309c>u, p.His437Tyr
Original code Patient 5
Description A point mutation in the exon 14 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Sep-2007 (Rel. 1, Created)
Date 13-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17676033
RefAuthors Minegishi, Y., Saito, M., Tsuchiya, S., Tsuge, I., Takada,
RefAuthors H., Hara, T., Kawamura, N., Ariga, T., Pasic, S.,
RefAuthors Stojkovic, O., Metin, A., Karasuyama, H.
RefTitle Dominant-negative mutations in the DNA-binding domain of
RefTitle STAT3 cause hyper-igE syndrome.
RefLoc Nature:1058-1062 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 60836
Feature /change: c -> t
Feature /genomic_region: exon; 14
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1549
Feature /codon: cac -> tac; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 437
Feature /change: H -> Y
Feature /domain: DNA-binding
Age 13
Sex XX
Family history De novo
//
ID #V463-1(1); standard; MUTATION; DNA-binding
Accession S0005
Systematic name g.61968_61970delGTG, c.1387_1389delGTG, r.1387_1389delgug,
Systematic name p.Val463del
Original code Patient 1
Description An inframe deletion in the exon 15 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Sep-2007 (Rel. 1, Created)
Date 13-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17676033
RefAuthors Minegishi, Y., Saito, M., Tsuchiya, S., Tsuge, I., Takada,
RefAuthors H., Hara, T., Kawamura, N., Ariga, T., Pasic, S.,
RefAuthors Stojkovic, O., Metin, A., Karasuyama, H.
RefTitle Dominant-negative mutations in the DNA-binding domain of
RefTitle STAT3 cause hyper-igE syndrome.
RefLoc Nature:1058-1062 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0128: 61968..61970
Feature /change: -gtg
Feature /genomic_region: exon; 15
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1627..1629
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P40763; STAT3_HUMAN: 463
Feature /change: -V
Feature /domain: DNA-binding
Age 21
Sex XX
Family history De novo
//
ID #V463-1(2); standard; MUTATION; DNA-binding
Accession S0006
Systematic name g.61968_61970delGTG, c.1387_1389delGTG, r.1387_1389delgug,
Systematic name p.Val463del
Original code Patient 3
Description An inframe deletion in the exon 15 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Sep-2007 (Rel. 1, Created)
Date 13-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17676033
RefAuthors Minegishi, Y., Saito, M., Tsuchiya, S., Tsuge, I., Takada,
RefAuthors H., Hara, T., Kawamura, N., Ariga, T., Pasic, S.,
RefAuthors Stojkovic, O., Metin, A., Karasuyama, H.
RefTitle Dominant-negative mutations in the DNA-binding domain of
RefTitle STAT3 cause hyper-igE syndrome.
RefLoc Nature:1058-1062 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0128: 61968..61970
Feature /change: -gtg
Feature /genomic_region: exon; 15
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1627..1629
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P40763; STAT3_HUMAN: 463
Feature /change: -V
Feature /domain: DNA-binding
Age 19
Sex XY
Family history De novo
//
ID #V463-1(3); standard; MUTATION; DNA-binding
Accession S0007
Systematic name g.61968_61970delGTG, c.1387_1389delGTG, r.1387_1389delgug,
Systematic name p.Val463del
Original code Patient 8
Description An inframe deletion in the exon 15 leading to an amino acid
Description change in the DNA-binding domain
Date 13-Sep-2007 (Rel. 1, Created)
Date 13-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17676033
RefAuthors Minegishi, Y., Saito, M., Tsuchiya, S., Tsuge, I., Takada,
RefAuthors H., Hara, T., Kawamura, N., Ariga, T., Pasic, S.,
RefAuthors Stojkovic, O., Metin, A., Karasuyama, H.
RefTitle Dominant-negative mutations in the DNA-binding domain of
RefTitle STAT3 cause hyper-igE syndrome.
RefLoc Nature:1058-1062 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0128: 61968..61970
Feature /change: -gtg
Feature /genomic_region: exon; 15
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1627..1629
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P40763; STAT3_HUMAN: 463
Feature /change: -V
Feature /domain: DNA-binding
Age 6
Sex XY
Family history De novo
//
ID #V463-1(4); standard; MUTATION; DNA-binding
Accession S0023
Systematic name g.61968_61970delGTG, c.1387_1389delGTG, r.1387_1389delgug,
Systematic name p.Val463del
Original code Family J012; Proband
Description An inframe deletion in the exon 15 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0128: 61968..61970
Feature /change: -gtg
Feature /genomic_region: exon; 15
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1627..1629
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P40763; STAT3_HUMAN: 463
Feature /change: -V
Feature /domain: DNA-binding
Ethnic origin Caucasoid
Family history Sporadic
//
ID #V463-1(5a); standard; MUTATION; DNA-binding
Accession S0050
Systematic name g.61968_61970delGTG, c.1387_1389delGTG, r.1387_1389delgug,
Systematic name p.Val463del
Original code Family J087; Proband
Description An inframe deletion in the exon 15 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0128: 61968..61970
Feature /change: -gtg
Feature /genomic_region: exon; 15
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1627..1629
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P40763; STAT3_HUMAN: 463
Feature /change: -V
Feature /domain: DNA-binding
Ethnic origin Caucasoid
Family history Sporadic
Relative STAT3base; S0051 daughter
//
ID #V463-1(5b); standard; MUTATION; DNA-binding
Accession S0051
Systematic name g.61968_61970delGTG, c.1387_1389delGTG, r.1387_1389delgug,
Systematic name p.Val463del
Original code Family J087; Daughter
Description An inframe deletion in the exon 15 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0128: 61968..61970
Feature /change: -gtg
Feature /genomic_region: exon; 15
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1627..1629
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P40763; STAT3_HUMAN: 463
Feature /change: -V
Feature /domain: DNA-binding
Ethnic origin Caucasoid
Family history Inherited
Relative STAT3base; S0050 parent
//
ID S465A(1); standard; MUTATION; DNA-binding
Accession S0044
Systematic name g.61974T>G, c.1393T>G, r.1393u>g, p.Ser465Ala
Original code Family J054; Proband
Description A point mutation in the exon 15 leading to an amino acid
Description change in the DNA-binding domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 61974
Feature /change: t -> g
Feature /genomic_region: exon; 15
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1633
Feature /codon: tcc -> gcc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 465
Feature /change: S -> A
Feature /domain: DNA-binding
Ethnic origin Caucasoid
Family history Sporadic
//
ID K531E(1); standard; MUTATION; Linker
Accession S0090
Systematic name g.62288A>G, c.1591A>G, r.1591a>g, p.Lys531Glu
Description A point mutation in the exon 16 leading to an amino acid
Description change in the Linker domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 19348930
RefAuthors Kim, H. J., Kim, J. H., Shin, Y. K., Lee, S. I., Ahn, K.
RefAuthors M.
RefTitle A novel mutation in the linker domain of the signal
RefTitle transducer and activator of transcription 3 gene,
RefTitle p.lys531Glu, in hyper-igE syndrome.
RefLoc J Allergy Clin Immunol:956-958 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 62288
Feature /change: a -> g
Feature /genomic_region: exon; 16
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 1831
Feature /codon: aaa -> gaa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 531
Feature /change: K -> E
Feature /domain: Linker
Symptoms Fever; Cough; Otorrhea; Dermatitis; Cervical lymphadenitis;
Symptoms Candidiasis; Otitis media
Age 5
Sex XY
Ethnic origin Korea
//
ID S611N(1); standard; MUTATION; SH2
Accession S0019
Systematic name g.63948G>A, c.1832G>A, r.1832g>a, p.Ser611Asn
Original code Family J009; Proband
Description A point mutation in the exon 19 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 63948
Feature /change: g -> a
Feature /genomic_region: exon; 19
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2072
Feature /codon: agt -> aat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 611
Feature /change: S -> N
Feature /domain: SH2
Ethnic origin Caucasoid
Family history Sporadic
//
ID F621L(1); standard; MUTATION; SH2
Accession S0083
Systematic name g.63979C>G, c.1863C>G, r.1863c>g, p.Phe621Leu
Original code 4-1
Description A point mutation in the exon 19 leading to an amino acid
Description change in the SH2 domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20093388
RefAuthors Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine,
RefAuthors N. H., Leppert, M. F., Carey, J. C., Ochs, H. D.,
RefAuthors Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle Rapid molecular analysis of the STAT3 gene in job syndrome
RefTitle of hyper-igE and recurrent infectious diseases.
RefLoc J Mol Diagn:213-219 (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 63979
Feature /change: c -> g
Feature /genomic_region: exon; 19
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2103
Feature /codon: ttc -> ttg; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 621
Feature /change: F -> L
Feature /domain: SH2
Symptoms Eczema; Abscess; Candidiasis
IgE 9,477 IU/ml
Sex XX
Family history Not known
//
ID F621V(1); standard; MUTATION; SH2
Accession S0026
Systematic name g.63977T>G, c.1861T>G, r.1861u>g, p.Phe621Val
Original code Family J015; Proband
Description A point mutation in the exon 19 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 63977
Feature /change: t -> g
Feature /genomic_region: exon; 19
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2101
Feature /codon: ttc -> gtc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 621
Feature /change: F -> V
Feature /domain: SH2
Ethnic origin Caucasoid
Family history Sporadic
//
ID T622I(1a); standard; MUTATION; SH2
Accession S0011
Systematic name g.63981C>T, c.1865C>T, r.1865c>u, p.Thr622Ile
Original code Family J002; Proband
Description A point mutation in the exon 19 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 63981
Feature /change: c -> t
Feature /genomic_region: exon; 19
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2105
Feature /codon: act -> att; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 622
Feature /change: T -> I
Feature /domain: SH2
Sex XY
Ethnic origin Caucasoid
Family history De novo
Relative STAT3base; S0012 daughter
//
ID T622I(1b); standard; MUTATION; SH2
Accession S0012
Systematic name g.63981C>T, c.1865C>T, r.1865c>u, p.Thr622Ile
Original code Family J002; Daughter
Description A point mutation in the exon 19 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 63981
Feature /change: c -> t
Feature /genomic_region: exon; 19
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2105
Feature /codon: act -> att; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 622
Feature /change: T -> I
Feature /domain: SH2
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative STAT3base; S0011 father
//
ID V637L(1); standard; MUTATION; SH2
Accession S0053
Systematic name g.64534G>T, c.1909G>T, r.1909g>u, p.Val637Leu
Original code Family J098; Proband
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64534
Feature /change: g -> t
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature /codon: gtg -> ttg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature /change: V -> L
Feature /domain: SH2
Ethnic origin Caucasoid
Family history Sporadic
//
ID V637M(1a); standard; MUTATION; SH2
Accession S0021
Systematic name g.64534G>A, c.1909G>A, r.1909g>a, p.Val637Met
Original code Family J011; Proband
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64534
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature /change: V -> M
Feature /domain: SH2
Ethnic origin Caucasoid
Family history Inherited
Relative STAT3base; S0022 sister
//
ID V637M(1b); standard; MUTATION; SH2
Accession S0022
Systematic name g.64534G>A, c.1909G>A, r.1909g>a, p.Val637Met
Original code Family J011; Sister
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64534
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature /change: V -> M
Feature /domain: SH2
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative STAT3base; S0021 sibling
//
ID V637M(2); standard; MUTATION; SH2
Accession S0025
Systematic name g.64534G>A, c.1909G>A, r.1909g>a, p.Val637Met
Original code Family J014; Proband
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64534
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature /change: V -> M
Feature /domain: SH2
Sex XX
Ethnic origin Caucasoid
Family history De novo
//
ID V637M(3); standard; MUTATION; SH2
Accession S0035
Systematic name g.64534G>A, c.1909G>A, r.1909g>a, p.Val637Met
Original code Family J022; Proband
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64534
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature /change: V -> M
Feature /domain: SH2
Ethnic origin Caucasoid
Family history Sporadic
//
ID V637M(4a); standard; MUTATION; SH2
Accession S0040
Systematic name g.64534G>A, c.1909G>A, r.1909g>a, p.Val637Met
Original code Family J035; Proband
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64534
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature /change: V -> M
Feature /domain: SH2
Sex XY
Ethnic origin Caucasoid
Family history Sporadic
Relative STAT3base; S0041 daughter
//
ID V637M(4b); standard; MUTATION; SH2
Accession S0041
Systematic name g.64534G>A, c.1909G>A, r.1909g>a, p.Val637Met
Original code Family J035; Daughter
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64534
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature /change: V -> M
Feature /domain: SH2
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative STAT3base; S0040 father
//
ID V637M(5); standard; MUTATION; SH2
Accession S0049
Systematic name g.64534G>A, c.1909G>A, r.1909g>a, p.Val637Met
Original code Family J083; Proband
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64534
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature /change: V -> M
Feature /domain: SH2
Ethnic origin Caucasoid
Family history Sporadic
//
ID V637M(6); standard; MUTATION; SH2
Accession S0054
Systematic name g.64534G>A, c.1909G>A, r.1909g>a, p.Val637Met
Original code Family J100; Proband
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64534
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature /change: V -> M
Feature /domain: SH2
Ethnic origin Hispanic
Family history Sporadic
//
ID V637M(7); standard; MUTATION; SH2
Accession S0073
Systematic name g.64534G>A, c.1909G>A, r.1909g>a, p.Val637Met
Original code CA1
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18706697
RefAuthors Jiao, H., Toth, B., Erdos, M., Fransson, I., Rakoczi, E.,
RefAuthors Balogh, I., Magyarics, Z., Derfalvi, B., Csorba, G.,
RefAuthors Szaflarska, A., Megarbane, A., Akatcherian, C., Dbaibo,
RefAuthors G., Rajnavolgyi, E., Hammarstrom, L., Kere, J., Lefranc,
RefAuthors G., Marodi, L.
RefTitle Novel and recurrent STAT3 mutations in hyper-igE syndrome
RefTitle patients from different ethnic groups.
RefLoc Mol Immunol:202-206 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64534
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature /change: V -> M
Feature /domain: SH2
Symptoms Severe eczema; Skin abscess; Dental infections; Otitis;
Symptoms Candidiasis; Pneumonia; Pneumatocele; Pectus exacavatum
Age 22
Sex XY
Ethnic origin Lebanon
//
ID V637M(8); standard; MUTATION; SH2
Accession S0074
Systematic name g.64534G>A, c.1909G>A, r.1909g>a, p.Val637Met
Original code B
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18706697
RefAuthors Jiao, H., Toth, B., Erdos, M., Fransson, I., Rakoczi, E.,
RefAuthors Balogh, I., Magyarics, Z., Derfalvi, B., Csorba, G.,
RefAuthors Szaflarska, A., Megarbane, A., Akatcherian, C., Dbaibo,
RefAuthors G., Rajnavolgyi, E., Hammarstrom, L., Kere, J., Lefranc,
RefAuthors G., Marodi, L.
RefTitle Novel and recurrent STAT3 mutations in hyper-igE syndrome
RefTitle patients from different ethnic groups.
RefLoc Mol Immunol:202-206 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64534
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature /change: V -> M
Feature /domain: SH2
Symptoms Moderate eczema; Candidiasis; Conjunctivitis; Otitis;
Symptoms Pyodermia; Candidiasis; Pneumonia; Face of job
Age 3
Sex XX
Ethnic origin Poland
//
ID E638G(1); standard; MUTATION; SH2
Accession S0082
Systematic name g.64538A>G, c.1913A>G, r.1913a>g, p.Glu638Gly
Original code 3-1
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20093388
RefAuthors Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine,
RefAuthors N. H., Leppert, M. F., Carey, J. C., Ochs, H. D.,
RefAuthors Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle Rapid molecular analysis of the STAT3 gene in job syndrome
RefTitle of hyper-igE and recurrent infectious diseases.
RefLoc J Mol Diagn:213-219 (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64538
Feature /change: a -> g
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2153
Feature /codon: gaa -> gga; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 638
Feature /change: E -> G
Feature /domain: SH2
Symptoms Eczema; Abscess; Pneumonia; Candidiasis
IgE 3,206 IU/ml
Sex XY
Family history De novo
//
ID P639A(1); standard; MUTATION; SH2
Accession S0043
Systematic name g.64540C>G, c.1915C>G, r.1915c>g, p.Pro639Ala
Original code Family J053; Proband
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64540
Feature /change: c -> g
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2155
Feature /codon: cca -> gca; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 639
Feature /change: P -> A
Feature /domain: SH2
Ethnic origin Caucasoid
Family history Sporadic
//
ID Q644P(1); standard; MUTATION; SH2
Accession S0064
Systematic name g.64556A>C, c.1931A>C, r.1931a>c, p.Gln644Pro
Original code HIES5
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 13-Jul-2010 (Rel. 1, Created)
Date 13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18591410
RefAuthors Ma, C. S., Chew, G. Y., Simpson, N., Priyadarshi, A.,
RefAuthors Wong, M., Grimbacher, B., Fulcher, D. A., Tangye, S. G.,
RefAuthors Cook, M. C.
RefTitle Deficiency of th17 cells in hyper igE syndrome due to
RefTitle mutations in STAT3.
RefLoc J Exp Med:1551-1557 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64556
Feature /change: a -> c
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2171
Feature /codon: cag -> ccg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 644
Feature /change: Q -> P
Feature /domain: SH2
Symptoms Staphylococcus aureus pneumonia and abscesses; candidiasis;
Symptoms parenchymal lung damage; retained primary teeth
Age 42
Sex XX
//
ID #Q644-1(1); standard; MUTATION; SH2
Accession S0058
Systematic name g.64555_64557delCAG, c.1930_1932delCAG, r.1930_1932delcag,
Systematic name p.Gln644del
Original code Family J121; Proband
Description An inframe deletion in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0128: 64555..64557
Feature /change: -cag
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2170..2172
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P40763; STAT3_HUMAN: 644
Feature /change: -Q
Feature /domain: SH2
Ethnic origin Caucasoid
Family history Sporadic
//
ID N647D(1a); standard; MUTATION; SH2
Accession S0036
Systematic name g.64564A>G, c.1939A>G, r.1939a>g, p.Asn647Asp
Original code Family J029; Proband
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64564
Feature /change: a -> g
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2179
Feature /codon: aac -> gac; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 647
Feature /change: N -> D
Feature /domain: SH2
Ethnic origin Caucasoid
Family history Inherited
Relative STAT3base; S0037 sister
Relative STAT3base; S0038 niece
//
ID N647D(1b); standard; MUTATION; SH2
Accession S0037
Systematic name g.64564A>G, c.1939A>G, r.1939a>g, p.Asn647Asp
Original code Family J029; Sister
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64564
Feature /change: a -> g
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2179
Feature /codon: aac -> gac; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 647
Feature /change: N -> D
Feature /domain: SH2
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative STAT3base; S0036 sibling
Relative STAT3base; S0038
//
ID N647D(1c); standard; MUTATION; SH2
Accession S0038
Systematic name g.64564A>G, c.1939A>G, r.1939a>g, p.Asn647Asp
Original code Family J029; Niece
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64564
Feature /change: a -> g
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2179
Feature /codon: aac -> gac; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 647
Feature /change: N -> D
Feature /domain: SH2
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative STAT3base; S0036 aunt
Relative STAT3base; S0037
//
ID E652K(1a); standard; MUTATION; SH2
Accession S0046
Systematic name g.64579G>A, c.1954G>A, r.1954g>a, p.Glu652Lys
Original code Family J074; Proband
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64579
Feature /change: g -> a
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2194
Feature /codon: gaa -> aaa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 652
Feature /change: E -> K
Feature /domain: SH2
Sex XX
Ethnic origin Caucasoid
Family history Sporadic
Relative STAT3base; S0047 daughter
Relative STAT3base; S0048 daughter
//
ID E652K(1b); standard; MUTATION; SH2
Accession S0047
Systematic name g.64579G>A, c.1954G>A, r.1954g>a, p.Glu652Lys
Original code Family J074; Daughter
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64579
Feature /change: g -> a
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2194
Feature /codon: gaa -> aaa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 652
Feature /change: E -> K
Feature /domain: SH2
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative STAT3base; S0046 mother
Relative STAT3base; S0048 sister
//
ID E652K(1c); standard; MUTATION; SH2
Accession S0048
Systematic name g.64579G>A, c.1954G>A, r.1954g>a, p.Glu652Lys
Original code Family J074; Daughter
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64579
Feature /change: g -> a
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2194
Feature /codon: gaa -> aaa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 652
Feature /change: E -> K
Feature /domain: SH2
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative STAT3base; S0046 mother
Relative STAT3base; S0047 sister
//
ID Y657C(1a); standard; MUTATION; SH2
Accession S0055
Systematic name g.64595A>G, c.1970A>G, r.1970a>g, p.Tyr657Cys
Original code Family J112; Proband
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64595
Feature /change: a -> g
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2210
Feature /codon: tat -> tgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 657
Feature /change: Y -> C
Feature /domain: SH2
Ethnic origin Caucasoid
Family history Sporadic
Relative STAT3base; S0056 son
//
ID Y657C(1b); standard; MUTATION; SH2
Accession S0056
Systematic name g.64595A>G, c.1970A>G, r.1970a>g, p.Tyr657Cys
Original code Family J112; Son
Description A point mutation in the exon 20 leading to an amino acid
Description change in the SH2 domain
Date 21-Sep-2007 (Rel. 1, Created)
Date 21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17881745
RefAuthors Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P.,
RefAuthors Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A.,
RefAuthors Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N.,
RefAuthors Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L.,
RefAuthors Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich,
RefAuthors J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck,
RefAuthors J. M., Grimbacher, B.
RefTitle STAT3 mutations in the hyper-igE syndrome.
RefLoc N Engl J Med:S (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0128: 64595
Feature /change: a -> g
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2210
Feature /codon: tat -> tgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P40763; STAT3_HUMAN: 657
Feature /change: Y -> C
Feature /domain: SH2
Ethnic origin Caucasoid
Family history Inherited
Relative STAT3base; S0055 parent
//
ID #E690-10(1a); standard; MUTATION; Transactivation
Accession S0092
Systematic name g.64694_64723delAGAGCCAGGAGCATCCTGAAGCTGACCCAG,
Systematic name c.2069_2098delAGAGCCAGGAGCATCCTGAAGCTGACCCAG,
Systematic name r.2069_2098delagagccaggagcauccugaagcugacccag, p.Glu690del
Original code 7-1
Description An inframe deletion in the exon 20 leading to an amino acid
Description change in the Transactivation domain
Date 03-Aug-2010 (Rel. 1, Created)
Date 03-Aug-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20093388
RefAuthors Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine,
RefAuthors N. H., Leppert, M. F., Carey, J. C., Ochs, H. D.,
RefAuthors Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle Rapid molecular analysis of the STAT3 gene in job syndrome
RefTitle of hyper-igE and recurrent infectious diseases.
RefLoc J Mol Diagn:213-219 (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0128: 64694..64723
Feature /change: -agagccagga gcatcctgaa gctgacccag
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2309..2338
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P40763; STAT3_HUMAN: 690..700
Feature /change: ESQEHPEADP G -> G
Feature /domain: Transactivation
Symptoms ECzema; Abscess; Pneumonia; Candida infection;
IgE 8127 IU/ml
Sex XY
Family history De novo
Relative STAT3base; S0093 unknown
Relative STAT3base; S0094 unknown
//
ID #E690-10(1b); standard; MUTATION; Transactivation
Accession S0093
Systematic name g.64694_64723delAGAGCCAGGAGCATCCTGAAGCTGACCCAG,
Systematic name c.2069_2098delAGAGCCAGGAGCATCCTGAAGCTGACCCAG,
Systematic name r.2069_2098delagagccaggagcauccugaagcugacccag, p.Glu690del
Original code 7-2
Description An inframe deletion in the exon 20 leading to an amino acid
Description change in the Transactivation domain
Date 03-Aug-2010 (Rel. 1, Created)
Date 03-Aug-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20093388
RefAuthors Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine,
RefAuthors N. H., Leppert, M. F., Carey, J. C., Ochs, H. D.,
RefAuthors Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle Rapid molecular analysis of the STAT3 gene in job syndrome
RefTitle of hyper-igE and recurrent infectious diseases.
RefLoc J Mol Diagn:213-219 (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0128: 64694..64723
Feature /change: -agagccagga gcatcctgaa gctgacccag
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2309..2338
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P40763; STAT3_HUMAN: 690..700
Feature /change: ESQEHPEADP G -> G
Feature /domain: Transactivation
Symptoms ECzema; Abscess; Pneumonia; Candida infection;
IgE 1293 IU/ml
Sex XX
Family history Inherited
Relative STAT3base; S0092 unknown
Relative STAT3base; S0094 unknown
//
ID #E690-10(1c); standard; MUTATION; Transactivation
Accession S0094
Systematic name g.64694_64723delAGAGCCAGGAGCATCCTGAAGCTGACCCAG,
Systematic name c.2069_2098delAGAGCCAGGAGCATCCTGAAGCTGACCCAG,
Systematic name r.2069_2098delagagccaggagcauccugaagcugacccag, p.Glu690del
Original code 7-3
Description An inframe deletion in the exon 20 leading to an amino acid
Description change in the Transactivation domain
Date 03-Aug-2010 (Rel. 1, Created)
Date 03-Aug-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20093388
RefAuthors Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine,
RefAuthors N. H., Leppert, M. F., Carey, J. C., Ochs, H. D.,
RefAuthors Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle Rapid molecular analysis of the STAT3 gene in job syndrome
RefTitle of hyper-igE and recurrent infectious diseases.
RefLoc J Mol Diagn:213-219 (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0128: 64694..64723
Feature /change: -agagccagga gcatcctgaa gctgacccag
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0128; ; STAT3C: 2309..2338
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P40763; STAT3_HUMAN: 690..700
Feature /change: ESQEHPEADP G -> G
Feature /domain: Transactivation
Symptoms ECzema; Abscess; Pneumonia; Candida infection;
IgE 1909 IU/ml
Sex XX
Family history Inherited
Relative STAT3base; S0092 unknown
Relative STAT3base; S0093 unknown
//
|