ID-bases-logo
- databases for immunodeficiency-causing variations

   STAT3base
   Variation registry for  Hyper-IgE syndrome


Database        STAT3base
Version         1.1
File            stat3pub.html
Date            16-Jun-2011
Curator         Mauno Vihinen
Address         Protein Structure and Bioinformatics 
Address         Lund University, BMC D10, SE-22184 Lund, Sweden
Phone           +46 72 526 0022
Fax             +46 46 222 9328
Email           Mauno Vihinen
URL             http://structure.bmc.lu.se/idbase/STAT3base/
IDR factfile    http://structure.bmc.lu.se/idbase/IDRefSeq/xml/idr/ff/FF75.html
Gene            STAT3
Disease         Hyper-IgE syndrome 
OMIM            102582
Sequence        IDRefSeq:D0128; IDRefSeq:C0128; UniProt:P40763 
Numbering       start of the entry
Funding         Tampere University Hospital Medical Research Fund
Funding         European Union
Comments        sequence entry reference in every entry
//
ID              H332Y(1a); standard; MUTATION; DNA-binding
Accession       S0065
Systematic name g.53280C>T, c.994C>T, r.994c>u, p.His332Tyr
Original code   C1
Description     A point mutation in the exon 9 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18706697
RefAuthors      Jiao, H., Toth, B., Erdos, M., Fransson, I., Rakoczi, E., 
RefAuthors      Balogh, I., Magyarics, Z., Derfalvi, B., Csorba, G., 
RefAuthors      Szaflarska, A., Megarbane, A., Akatcherian, C., Dbaibo, 
RefAuthors      G., Rajnavolgyi, E., Hammarstrom, L., Kere, J., Lefranc, 
RefAuthors      G., Marodi, L.
RefTitle        Novel and recurrent STAT3 mutations in hyper-igE syndrome 
RefTitle        patients from different ethnic groups.
RefLoc          Mol Immunol:202-206 (2008)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 53280
Feature           /change: c -> t
Feature           /genomic_region: exon; 9
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1234
Feature           /codon: cat -> tat; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 332
Feature           /change: H -> Y
Feature           /domain: DNA-binding
Symptoms        Severe eczema; Cold abscess; Candidiasis; Pneumonia;
Symptoms        Bronchiectasis; Scoliosis; Pathologic fracture;
Symptoms        Face of job
Age             24
Sex             XX
Ethnic origin   Hungary
Relative        STAT3base; S0066 son
Relative        STAT3base; S0067 son
//
ID              H332Y(1b); standard; MUTATION; DNA-binding
Accession       S0066
Systematic name g.53280C>T, c.994C>T, r.994c>u, p.His332Tyr
Original code   C2
Description     A point mutation in the exon 9 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18706697
RefAuthors      Jiao, H., Toth, B., Erdos, M., Fransson, I., Rakoczi, E., 
RefAuthors      Balogh, I., Magyarics, Z., Derfalvi, B., Csorba, G., 
RefAuthors      Szaflarska, A., Megarbane, A., Akatcherian, C., Dbaibo, 
RefAuthors      G., Rajnavolgyi, E., Hammarstrom, L., Kere, J., Lefranc, 
RefAuthors      G., Marodi, L.
RefTitle        Novel and recurrent STAT3 mutations in hyper-igE syndrome 
RefTitle        patients from different ethnic groups.
RefLoc          Mol Immunol:202-206 (2008)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 53280
Feature           /change: c -> t
Feature           /genomic_region: exon; 9
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1234
Feature           /codon: cat -> tat; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 332
Feature           /change: H -> Y
Feature           /domain: DNA-binding
Symptoms        Severe eczema; Cold abscess; Pneumonia; Face of job
Age             5
Sex             XY
Ethnic origin   Hungary
Family history  Inherited
Relative        STAT3base; S0065 mother
Relative        STAT3base; S0067 brother
//
ID              H332Y(1c); standard; MUTATION; DNA-binding
Accession       S0067
Systematic name g.53280C>T, c.994C>T, r.994c>u, p.His332Tyr
Original code   C3
Description     A point mutation in the exon 9 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18706697
RefAuthors      Jiao, H., Toth, B., Erdos, M., Fransson, I., Rakoczi, E., 
RefAuthors      Balogh, I., Magyarics, Z., Derfalvi, B., Csorba, G., 
RefAuthors      Szaflarska, A., Megarbane, A., Akatcherian, C., Dbaibo, 
RefAuthors      G., Rajnavolgyi, E., Hammarstrom, L., Kere, J., Lefranc, 
RefAuthors      G., Marodi, L.
RefTitle        Novel and recurrent STAT3 mutations in hyper-igE syndrome 
RefTitle        patients from different ethnic groups.
RefLoc          Mol Immunol:202-206 (2008)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 53280
Feature           /change: c -> t
Feature           /genomic_region: exon; 9
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1234
Feature           /codon: cat -> tat; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 332
Feature           /change: H -> Y
Feature           /domain: DNA-binding
Symptoms        Severe eczema; Pyoderma; Pneumonia; Face of job
Age             3
Sex             XY
Ethnic origin   Hungary
Family history  Inherited
Relative        STAT3base; S0065 mother
Relative        STAT3base; S0066 brother
//
ID              G342D(1); standard; MUTATION; DNA-binding
Accession       S0089
Systematic name g.53311G>A, c.1025G>A, r.1025g>a, p.Gly342Asp
Description     A point mutation in the exon 9 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 20149460
RefAuthors      Papanastasiou, A. D., Mantagos, S., Papanastasiou, D. A., 
RefAuthors      Zarkadis, I. K.
RefTitle        A novel mutation in the signal transducer and activator of 
RefTitle        transcription 3 (STAT3) gene, in hyper-igE syndrome.
RefLoc          Mol Immunol:1629-1634 (2010)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 53311
Feature           /change: g -> a
Feature           /genomic_region: exon; 9
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1265
Feature           /codon: ggc -> gac; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 342
Feature           /change: G -> D
Feature           /domain: DNA-binding
Symptoms        Fever; Cough; Dermatitis; Skin abscesses; Pneumonia;
Symptoms        Scoliosis
Age             12
Sex             XX
Ethnic origin   Greece
//
ID              R382G(1a); standard; MUTATION; DNA-binding
Accession       S0087
Systematic name g.57365C>G, c.1144C>G, r.1144c>g, p.Arg382Gly
Original code   6-1
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 20093388
RefAuthors      Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine, 
RefAuthors      N. H., Leppert, M. F., Carey, J. C., Ochs, H. D., 
RefAuthors      Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle        Rapid molecular analysis of the STAT3 gene in job syndrome 
RefTitle        of hyper-igE and recurrent infectious diseases.
RefLoc          J Mol Diagn:213-219 (2010)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57365
Feature           /change: c -> g
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature           /codon: cgg -> ggg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> G
Feature           /domain: DNA-binding
Symptoms        Eczema; Abscess; Pneumonia; Candidiasis
IgE             21,700 IU/ml
Sex             XX
Family history  De novo
Relative        STAT3base; S0088 unknown
//
ID              R382G(1b); standard; MUTATION; DNA-binding
Accession       S0088
Systematic name g.57365C>G, c.1144C>G, r.1144c>g, p.Arg382Gly
Original code   6-2
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 20093388
RefAuthors      Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine, 
RefAuthors      N. H., Leppert, M. F., Carey, J. C., Ochs, H. D., 
RefAuthors      Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle        Rapid molecular analysis of the STAT3 gene in job syndrome 
RefTitle        of hyper-igE and recurrent infectious diseases.
RefLoc          J Mol Diagn:213-219 (2010)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57365
Feature           /change: c -> g
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature           /codon: cgg -> ggg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> G
Feature           /domain: DNA-binding
Symptoms        Eczema; Abscess; Pneumonia; Candidiasis
IgE             334 IU/ml
Sex             XY
Family history  Inherited
Relative        STAT3base; S0087 unknown
//
ID              R382L(1); standard; MUTATION; DNA-binding
Accession       S0052
Systematic name g.57366G>T, c.1145G>T, r.1145g>u, p.Arg382Leu
Original code   Family J088; Proband
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57366
Feature           /change: g -> t
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature           /codon: cgg -> ctg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> L
Feature           /domain: DNA-binding
Ethnic origin   White-Hispanic
Family history  Sporadic
//
ID              R382Q(1); standard; MUTATION; DNA-binding
Accession       S0008
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code   Patient 4
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Sep-2007 (Rel. 1, Created)
Date            13-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17676033
RefAuthors      Minegishi, Y., Saito, M., Tsuchiya, S., Tsuge, I., Takada, 
RefAuthors      H., Hara, T., Kawamura, N., Ariga, T., Pasic, S., 
RefAuthors      Stojkovic, O., Metin, A., Karasuyama, H.
RefTitle        Dominant-negative mutations in the DNA-binding domain of 
RefTitle        STAT3 cause hyper-igE syndrome.
RefLoc          Nature:1058-1062 (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57366
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature           /codon: cgg -> cag; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> Q
Feature           /domain: DNA-binding
Age             10
Sex             XY
Family history  De novo
//
ID              R382Q(2); standard; MUTATION; DNA-binding
Accession       S0018
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code   Family J008; Proband
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57366
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature           /codon: cgg -> cag; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> Q
Feature           /domain: DNA-binding
Ethnic origin   Caucasoid
Family history  De novo
//
ID              R382Q(3a); standard; MUTATION; DNA-binding
Accession       S0030
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code   Family J017; Proband
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57366
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature           /codon: cgg -> cag; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> Q
Feature           /domain: DNA-binding
Ethnic origin   Caucasoid
Family history  Inherited
Relative        STAT3base; S0031 father
Relative        STAT3base; S0032 brother
//
ID              R382Q(3b); standard; MUTATION; DNA-binding
Accession       S0031
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code   Family J017; Father
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57366
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature           /codon: cgg -> cag; 2
Feature           /note: mosaic
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> Q
Feature           /domain: DNA-binding
Sex             XY
Ethnic origin   Caucasoid
Family history  Sporadic
Relative        STAT3base; S0030 child
Relative        STAT3base; S0032 son
//
ID              R382Q(3c); standard; MUTATION; DNA-binding
Accession       S0032
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code   Family J017; Brother
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57366
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature           /codon: cgg -> cag; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> Q
Feature           /domain: DNA-binding
Sex             XY
Ethnic origin   Caucasoid
Family history  Inherited
Relative        STAT3base; S0030 sibling
Relative        STAT3base; S0031 father
//
ID              R382Q(4); standard; MUTATION; DNA-binding
Accession       S0034
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code   Family J021; Proband
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57366
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature           /codon: cgg -> cag; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> Q
Feature           /domain: DNA-binding
Ethnic origin   Negroid
Family history  Sporadic
//
ID              R382Q(5); standard; MUTATION; DNA-binding
Accession       S0039
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code   Family J030; Proband
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57366
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature           /codon: cgg -> cag; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> Q
Feature           /domain: DNA-binding
Ethnic origin   Negroid
Family history  De novo
//
ID              R382Q(6); standard; MUTATION; DNA-binding
Accession       S0057
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code   Family J113; Proband
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57366
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature           /codon: cgg -> cag; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> Q
Feature           /domain: DNA-binding
Ethnic origin   Caucasoid
Family history  Sporadic
//
ID              R382Q(7); standard; MUTATION; DNA-binding
Accession       S0061
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code   HIES2
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18591410
RefAuthors      Ma, C. S., Chew, G. Y., Simpson, N., Priyadarshi, A., 
RefAuthors      Wong, M., Grimbacher, B., Fulcher, D. A., Tangye, S. G., 
RefAuthors      Cook, M. C.
RefTitle        Deficiency of th17 cells in hyper igE syndrome due to 
RefTitle        mutations in STAT3.
RefLoc          J Exp Med:1551-1557 (2008)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57366
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature           /codon: cgg -> cag; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> Q
Feature           /domain: DNA-binding
Symptoms        Staphylococcus aureus pneumonia and abscesses; fractures;
Symptoms        parenchymal lung damage; retained primary teeth
Age             18
Sex             XY
//
ID              R382Q(8); standard; MUTATION; DNA-binding
Accession       S0062
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code   HIES3
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18591410
RefAuthors      Ma, C. S., Chew, G. Y., Simpson, N., Priyadarshi, A., 
RefAuthors      Wong, M., Grimbacher, B., Fulcher, D. A., Tangye, S. G., 
RefAuthors      Cook, M. C.
RefTitle        Deficiency of th17 cells in hyper igE syndrome due to 
RefTitle        mutations in STAT3.
RefLoc          J Exp Med:1551-1557 (2008)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57366
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature           /codon: cgg -> cag; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> Q
Feature           /domain: DNA-binding
Symptoms        Staphylococcus aureus abscesses; Fractures;
Symptoms        Retained primary teeth; candidiasis
Age             15
Sex             XY
//
ID              R382Q(9a); standard; MUTATION; DNA-binding
Accession       S0076
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code   1-1
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 20093388
RefAuthors      Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine, 
RefAuthors      N. H., Leppert, M. F., Carey, J. C., Ochs, H. D., 
RefAuthors      Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle        Rapid molecular analysis of the STAT3 gene in job syndrome 
RefTitle        of hyper-igE and recurrent infectious diseases.
RefLoc          J Mol Diagn:213-219 (2010)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57366
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature           /codon: cgg -> cag; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> Q
Feature           /domain: DNA-binding
Symptoms        Eczema; Abscess; Pneumonia; Candidiasis
IgE             4,000 IU/ml
Sex             XY
Family history  De novo
Relative        STAT3base; S0077 unknown
Relative        STAT3base; S0078 unknown
//
ID              R382Q(9b); standard; MUTATION; DNA-binding
Accession       S0077
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code   1-2
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 20093388
RefAuthors      Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine, 
RefAuthors      N. H., Leppert, M. F., Carey, J. C., Ochs, H. D., 
RefAuthors      Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle        Rapid molecular analysis of the STAT3 gene in job syndrome 
RefTitle        of hyper-igE and recurrent infectious diseases.
RefLoc          J Mol Diagn:213-219 (2010)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57366
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature           /codon: cgg -> cag; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> Q
Feature           /domain: DNA-binding
Symptoms        Eczema; Abscess; Pneumonia; Candidiasis
IgE             98,766 IU/ml
Sex             XX
Family history  Inherited
Relative        STAT3base; S0076 unknown
Relative        STAT3base; S0078 unknown
//
ID              R382Q(9c); standard; MUTATION; DNA-binding
Accession       S0078
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code   1-3
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 20093388
RefAuthors      Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine, 
RefAuthors      N. H., Leppert, M. F., Carey, J. C., Ochs, H. D., 
RefAuthors      Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle        Rapid molecular analysis of the STAT3 gene in job syndrome 
RefTitle        of hyper-igE and recurrent infectious diseases.
RefLoc          J Mol Diagn:213-219 (2010)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57366
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature           /codon: cgg -> cag; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> Q
Feature           /domain: DNA-binding
Symptoms        Eczema; Abscess; Pneumonia; Candidiasis
IgE             16,172 IU/ml
Sex             XX
Family history  Inherited
Relative        STAT3base; S0076 unknown
Relative        STAT3base; S0077 unknown
//
ID              R382Q(10); standard; MUTATION; DNA-binding
Accession       S0079
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code   2-1
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 20093388
RefAuthors      Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine, 
RefAuthors      N. H., Leppert, M. F., Carey, J. C., Ochs, H. D., 
RefAuthors      Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle        Rapid molecular analysis of the STAT3 gene in job syndrome 
RefTitle        of hyper-igE and recurrent infectious diseases.
RefLoc          J Mol Diagn:213-219 (2010)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57366
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature           /codon: cgg -> cag; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> Q
Feature           /domain: DNA-binding
Symptoms        Eczema; Abscess; Pneumonia; Candidiasis
IgE             1451 IU/ml
Sex             XY
Family history  Not known
//
ID              R382Q(11a); standard; MUTATION; DNA-binding
Accession       S0080
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code   10-1
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 20093388
RefAuthors      Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine, 
RefAuthors      N. H., Leppert, M. F., Carey, J. C., Ochs, H. D., 
RefAuthors      Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle        Rapid molecular analysis of the STAT3 gene in job syndrome 
RefTitle        of hyper-igE and recurrent infectious diseases.
RefLoc          J Mol Diagn:213-219 (2010)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57366
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature           /codon: cgg -> cag; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> Q
Feature           /domain: DNA-binding
Symptoms        Eczema; Abscess; Pneumonia; Candidiasis
IgE             15,776 IU/ml
Sex             XX
Family history  Not known
Relative        STAT3base; S0081 unknown
//
ID              R382Q(11b); standard; MUTATION; DNA-binding
Accession       S0081
Systematic name g.57366G>A, c.1145G>A, r.1145g>a, p.Arg382Gln
Original code   10-2
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 20093388
RefAuthors      Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine, 
RefAuthors      N. H., Leppert, M. F., Carey, J. C., Ochs, H. D., 
RefAuthors      Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle        Rapid molecular analysis of the STAT3 gene in job syndrome 
RefTitle        of hyper-igE and recurrent infectious diseases.
RefLoc          J Mol Diagn:213-219 (2010)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57366
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1385
Feature           /codon: cgg -> cag; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> Q
Feature           /domain: DNA-binding
Symptoms        Eczema; Abscess; Pneumonia; Candidiasis
IgE             40,009 IU/ml
Sex             XX
Family history  Not known
Relative        STAT3base; S0080 unknown
//
ID              R382W(1); standard; MUTATION; DNA-binding
Accession       S0001
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code   Patient 2
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Sep-2007 (Rel. 1, Created)
Date            13-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17676033
RefAuthors      Minegishi, Y., Saito, M., Tsuchiya, S., Tsuge, I., Takada, 
RefAuthors      H., Hara, T., Kawamura, N., Ariga, T., Pasic, S., 
RefAuthors      Stojkovic, O., Metin, A., Karasuyama, H.
RefTitle        Dominant-negative mutations in the DNA-binding domain of 
RefTitle        STAT3 cause hyper-igE syndrome.
RefLoc          Nature:1058-1062 (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57365
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature           /codon: cgg -> tgg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> W
Feature           /domain: DNA-binding
Age             9
Sex             XX
Family history  De novo
//
ID              R382W(2); standard; MUTATION; DNA-binding
Accession       S0002
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code   Patient 7
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Sep-2007 (Rel. 1, Created)
Date            13-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17676033
RefAuthors      Minegishi, Y., Saito, M., Tsuchiya, S., Tsuge, I., Takada, 
RefAuthors      H., Hara, T., Kawamura, N., Ariga, T., Pasic, S., 
RefAuthors      Stojkovic, O., Metin, A., Karasuyama, H.
RefTitle        Dominant-negative mutations in the DNA-binding domain of 
RefTitle        STAT3 cause hyper-igE syndrome.
RefLoc          Nature:1058-1062 (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57365
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature           /codon: cgg -> tgg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> W
Feature           /domain: DNA-binding
Age             7
Sex             XY
Family history  De novo
//
ID              R382W(3a); standard; MUTATION; DNA-binding
Accession       S0009
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code   Family J001; Proband
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57365
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature           /codon: cgg -> tgg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> W
Feature           /domain: DNA-binding
Sex             XX
Ethnic origin   Caucasoid
Family history  Sporadic
Relative        STAT3base; S0010 daughter
//
ID              R382W(3b); standard; MUTATION; DNA-binding
Accession       S0010
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code   Family J001; Daughter
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57365
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature           /codon: cgg -> tgg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> W
Feature           /domain: DNA-binding
Sex             XX
Ethnic origin   Caucasoid
Family history  Inherited
Relative        STAT3base; S0009 mother
//
ID              R382W(4); standard; MUTATION; DNA-binding
Accession       S0013
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code   Family J004; proband
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57365
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature           /codon: cgg -> tgg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> W
Feature           /domain: DNA-binding
Ethnic origin   Caucasoid
Family history  Sporadic
//
ID              R382W(5); standard; MUTATION; DNA-binding
Accession       S0014
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code   Family J005; proband
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57365
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature           /codon: cgg -> tgg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> W
Feature           /domain: DNA-binding
Ethnic origin   Caucasoid/Negroid
Family history  De novo
//
ID              R382W(6); standard; MUTATION; DNA-binding
Accession       S0020
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code   Family J010; Proband
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57365
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature           /codon: cgg -> tgg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> W
Feature           /domain: DNA-binding
Ethnic origin   Caucasoid
Family history  De novo
//
ID              R382W(7); standard; MUTATION; DNA-binding
Accession       S0033
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code   Family J020; Proband
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57365
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature           /codon: cgg -> tgg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> W
Feature           /domain: DNA-binding
Ethnic origin   Negroid
Family history  Sporadic
//
ID              R382W(8); standard; MUTATION; DNA-binding
Accession       S0042
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code   Family J045; Proband
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57365
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature           /codon: cgg -> tgg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> W
Feature           /domain: DNA-binding
Ethnic origin   Hispanic
Family history  Sporadic
//
ID              R382W(9); standard; MUTATION; DNA-binding
Accession       S0045
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code   Family J068; Proband
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57365
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature           /codon: cgg -> tgg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> W
Feature           /domain: DNA-binding
Ethnic origin   Caucasoid
Family history  Sporadic
//
ID              R382W(10); standard; MUTATION; DNA-binding
Accession       S0059
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code   patient
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            03-Jun-2008 (Rel. 1, Created)
Date            03-Jun-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17942886
RefAuthors      Renner, E. D., Torgerson, T. R., Rylaarsdam, S., Anover-
RefAuthors      Sombke, S., Golob, K., LaFlam, T., Zhu, Q., Ochs, H. D.
RefTitle        STAT3 mutation in the original patient with job's 
RefTitle        syndrome.
RefLoc          N Engl J Med:1667-1668 (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57365
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature           /codon: cgg -> tgg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> W
Feature           /domain: DNA-binding
Symptoms        Eczema, multiple atraumatic fractures, candida infection,
Symptoms        recurrent Staphylococcus aureus abscesses, pneumonia with
Symptoms        lung abscesses and formation of pneumatoceles
Sex             XX
//
ID              R382W(11a); standard; MUTATION; DNA-binding
Accession       S0068
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code   N1
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18706697
RefAuthors      Jiao, H., Toth, B., Erdos, M., Fransson, I., Rakoczi, E., 
RefAuthors      Balogh, I., Magyarics, Z., Derfalvi, B., Csorba, G., 
RefAuthors      Szaflarska, A., Megarbane, A., Akatcherian, C., Dbaibo, 
RefAuthors      G., Rajnavolgyi, E., Hammarstrom, L., Kere, J., Lefranc, 
RefAuthors      G., Marodi, L.
RefTitle        Novel and recurrent STAT3 mutations in hyper-igE syndrome 
RefTitle        patients from different ethnic groups.
RefLoc          Mol Immunol:202-206 (2008)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57365
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature           /codon: cgg -> tgg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> W
Feature           /domain: DNA-binding
Symptoms        Severe eczema; Pneumatocele; Candidiasis; Cold abscess;
Symptoms        Pneumonia; Face of job; Pathologic fracture; Scoliosis;
Symptoms        Hyperextensibility
Age             40
Sex             XX
Ethnic origin   Hungary
Relative        STAT3base; S0069 daughter
Comment         Nephrectomy was done at 7 years age.
//
ID              R382W(11b); standard; MUTATION; DNA-binding
Accession       S0069
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code   N2
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18706697
RefAuthors      Jiao, H., Toth, B., Erdos, M., Fransson, I., Rakoczi, E., 
RefAuthors      Balogh, I., Magyarics, Z., Derfalvi, B., Csorba, G., 
RefAuthors      Szaflarska, A., Megarbane, A., Akatcherian, C., Dbaibo, 
RefAuthors      G., Rajnavolgyi, E., Hammarstrom, L., Kere, J., Lefranc, 
RefAuthors      G., Marodi, L.
RefTitle        Novel and recurrent STAT3 mutations in hyper-igE syndrome 
RefTitle        patients from different ethnic groups.
RefLoc          Mol Immunol:202-206 (2008)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57365
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature           /codon: cgg -> tgg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> W
Feature           /domain: DNA-binding
Symptoms        Mild eczema; Newborn rash; Cold abscess; Pneumonia;
Symptoms        Face of job; Hyperextensibility
Age             8
Sex             XX
Ethnic origin   Hungary
Family history  Inherited
Relative        STAT3base; S0068 mother
//
ID              R382W(12); standard; MUTATION; DNA-binding
Accession       S0070
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code   K
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18706697
RefAuthors      Jiao, H., Toth, B., Erdos, M., Fransson, I., Rakoczi, E., 
RefAuthors      Balogh, I., Magyarics, Z., Derfalvi, B., Csorba, G., 
RefAuthors      Szaflarska, A., Megarbane, A., Akatcherian, C., Dbaibo, 
RefAuthors      G., Rajnavolgyi, E., Hammarstrom, L., Kere, J., Lefranc, 
RefAuthors      G., Marodi, L.
RefTitle        Novel and recurrent STAT3 mutations in hyper-igE syndrome 
RefTitle        patients from different ethnic groups.
RefLoc          Mol Immunol:202-206 (2008)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57365
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature           /codon: cgg -> tgg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> W
Feature           /domain: DNA-binding
Symptoms        Moderate eczema; Newborn rash; Cold abscess;
Symptoms        Oral candidiasis; Pneumonia; Face of job; Hyperextensibility
Age             5
Sex             XY
Ethnic origin   Hungary
//
ID              R382W(13); standard; MUTATION; DNA-binding
Accession       S0071
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code   S1
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18706697
RefAuthors      Jiao, H., Toth, B., Erdos, M., Fransson, I., Rakoczi, E., 
RefAuthors      Balogh, I., Magyarics, Z., Derfalvi, B., Csorba, G., 
RefAuthors      Szaflarska, A., Megarbane, A., Akatcherian, C., Dbaibo, 
RefAuthors      G., Rajnavolgyi, E., Hammarstrom, L., Kere, J., Lefranc, 
RefAuthors      G., Marodi, L.
RefTitle        Novel and recurrent STAT3 mutations in hyper-igE syndrome 
RefTitle        patients from different ethnic groups.
RefLoc          Mol Immunol:202-206 (2008)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57365
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature           /codon: cgg -> tgg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> W
Feature           /domain: DNA-binding
Symptoms        Severe eczema; Skin abscess; Oral candidiasis; Sinusitis;
Symptoms        Otitis; Pneumonia; Face of job; Hyperextensibility
Age             9
Sex             XY
Ethnic origin   Hungary
//
ID              R382W(14); standard; MUTATION; DNA-binding
Accession       S0072
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code   SW
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18706697
RefAuthors      Jiao, H., Toth, B., Erdos, M., Fransson, I., Rakoczi, E., 
RefAuthors      Balogh, I., Magyarics, Z., Derfalvi, B., Csorba, G., 
RefAuthors      Szaflarska, A., Megarbane, A., Akatcherian, C., Dbaibo, 
RefAuthors      G., Rajnavolgyi, E., Hammarstrom, L., Kere, J., Lefranc, 
RefAuthors      G., Marodi, L.
RefTitle        Novel and recurrent STAT3 mutations in hyper-igE syndrome 
RefTitle        patients from different ethnic groups.
RefLoc          Mol Immunol:202-206 (2008)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57365
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature           /codon: cgg -> tgg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> W
Feature           /domain: DNA-binding
Symptoms        Moderate eczema; Skin abscess; Dental infections; Otitis;
Symptoms        Pneumonia; Empyema; Bronchiectasis; Osteitis
Age             25
Sex             XY
Ethnic origin   Sweden
//
ID              R382W(15); standard; MUTATION; DNA-binding
Accession       S0084
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code   5-1
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 20093388
RefAuthors      Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine, 
RefAuthors      N. H., Leppert, M. F., Carey, J. C., Ochs, H. D., 
RefAuthors      Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle        Rapid molecular analysis of the STAT3 gene in job syndrome 
RefTitle        of hyper-igE and recurrent infectious diseases.
RefLoc          J Mol Diagn:213-219 (2010)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57365
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature           /codon: cgg -> tgg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> W
Feature           /domain: DNA-binding
Symptoms        Eczema; Abscess; Pneumonia; Candidiasis
IgE             8,000 IU/ml
Sex             XY
Family history  Not known
//
ID              R382W(16); standard; MUTATION; DNA-binding
Accession       S0085
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code   8-1
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 20093388
RefAuthors      Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine, 
RefAuthors      N. H., Leppert, M. F., Carey, J. C., Ochs, H. D., 
RefAuthors      Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle        Rapid molecular analysis of the STAT3 gene in job syndrome 
RefTitle        of hyper-igE and recurrent infectious diseases.
RefLoc          J Mol Diagn:213-219 (2010)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57365
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature           /codon: cgg -> tgg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> W
Feature           /domain: DNA-binding
Symptoms        Eczema; Abscess; Pneumonia; Candidiasis
IgE             29,899 IU/ml
Sex             XY
Family history  Not known
//
ID              R382W(17); standard; MUTATION; DNA-binding
Accession       S0086
Systematic name g.57365C>T, c.1144C>T, r.1144c>u, p.Arg382Trp
Original code   9-1
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 20093388
RefAuthors      Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine, 
RefAuthors      N. H., Leppert, M. F., Carey, J. C., Ochs, H. D., 
RefAuthors      Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle        Rapid molecular analysis of the STAT3 gene in job syndrome 
RefTitle        of hyper-igE and recurrent infectious diseases.
RefLoc          J Mol Diagn:213-219 (2010)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57365
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1384
Feature           /codon: cgg -> tgg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 382
Feature           /change: R -> W
Feature           /domain: DNA-binding
IgE             38,918 IU/ml
Sex             XY
Family history  Not known
//
ID              F384L(1); standard; MUTATION; DNA-binding
Accession       S0024
Systematic name g.57371T>C, c.1150T>C, r.1150u>c, p.Phe384Leu
Original code   Family J013; Proband
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57371
Feature           /change: t -> c
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1390
Feature           /codon: ttt -> ctt; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 384
Feature           /change: F -> L
Feature           /domain: DNA-binding
Ethnic origin   Caucasoid
Family history  Sporadic
//
ID              F384S(1); standard; MUTATION; DNA-binding
Accession       S0015
Systematic name g.57372T>C, c.1151T>C, r.1151u>c, p.Phe384Ser
Original code   Family J006; proband
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57372
Feature           /change: t -> c
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1391
Feature           /codon: ttt -> tct; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 384
Feature           /change: F -> S
Feature           /domain: DNA-binding
Ethnic origin   Caucasoid
Family history  Sporadic
//
ID              T389I(1); standard; MUTATION; DNA-binding
Accession       S0003
Systematic name g.57387C>T, c.1166C>T, r.1166c>u, p.Thr389Ile
Original code   Patient 6
Description     A point mutation in the exon 12 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Sep-2007 (Rel. 1, Created)
Date            13-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17676033
RefAuthors      Minegishi, Y., Saito, M., Tsuchiya, S., Tsuge, I., Takada, 
RefAuthors      H., Hara, T., Kawamura, N., Ariga, T., Pasic, S., 
RefAuthors      Stojkovic, O., Metin, A., Karasuyama, H.
RefTitle        Dominant-negative mutations in the DNA-binding domain of 
RefTitle        STAT3 cause hyper-igE syndrome.
RefLoc          Nature:1058-1062 (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57387
Feature           /change: c -> t
Feature           /genomic_region: exon; 12
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1406
Feature           /codon: aca -> ata; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 389
Feature           /change: T -> I
Feature           /domain: DNA-binding
Age             7
Sex             XX
Family history  De novo
//
ID              T412S(1); standard; MUTATION; DNA-binding
Accession       S0075
Systematic name g.57551A>T, c.1234A>T, r.1234a>u, p.Thr412Ser
Description     A point mutation in the exon 13 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED;  19483664
RefAuthors      Powers, A. E., Bender, J. M., Kumanovics, A., Ampofo, K., 
RefAuthors      Augustine, N., Pavia, A. T., Hill, H. R.
RefTitle        Coccidioides immitis meningitis in a patient with 
RefTitle        hyperimmunoglobulin E syndrome due to a novel mutation in 
RefTitle        signal transducer and activator of transcription.
RefLoc          Pediatr Infect Dis J:664-666 (2009)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57551
Feature           /change: a -> t
Feature           /genomic_region: exon; 13
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1474
Feature           /codon: acc -> tcc; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 412
Feature           /change: T -> S
Feature           /domain: DNA-binding
Symptoms        Fever; Myalgias; Staphylococcus aureus infections;
Symptoms        Pneumonia; Recurrent sinus infection; Headache
Age             17
Sex             XX
Ethnic origin   United States
Family history  Inherited
Comment         Patient's sister had the same mutation.
Comment         Patient's father had HIES and died of cryptococcal
Comment         meningitis.
//
ID              R423Q(1a); standard; MUTATION; DNA-binding
Accession       S0016
Systematic name g.57585G>A, c.1268G>A, r.1268g>a, p.Arg423Gln
Original code   Family J007; Proband
Description     A point mutation in the exon 13 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57585
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 13
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1508
Feature           /codon: cga -> caa; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 423
Feature           /change: R -> Q
Feature           /domain: DNA-binding
Sex             XX
Ethnic origin   Caucasoid
Family history  Sporadic
Relative        STAT3base; S0017 daughter
//
ID              R423Q(1b); standard; MUTATION; DNA-binding
Accession       S0017
Systematic name g.57585G>A, c.1268G>A, r.1268g>a, p.Arg423Gln
Original code   Family J007; Daughter
Description     A point mutation in the exon 13 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57585
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 13
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1508
Feature           /codon: cga -> caa; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 423
Feature           /change: R -> Q
Feature           /domain: DNA-binding
Sex             XX
Ethnic origin   Caucasoid
Family history  Inherited
Relative        STAT3base; S0016 mother
//
ID              R423Q(2a); standard; MUTATION; DNA-binding
Accession       S0027
Systematic name g.57585G>A, c.1268G>A, r.1268g>a, p.Arg423Gln
Original code   Family J016; Proband
Description     A point mutation in the exon 13 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57585
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 13
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1508
Feature           /codon: cga -> caa; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 423
Feature           /change: R -> Q
Feature           /domain: DNA-binding
Sex             XY
Ethnic origin   Mongoloid
Family history  De novo
Relative        STAT3base; S0028 son
Relative        STAT3base; S0029 daughter
//
ID              R423Q(2b); standard; MUTATION; DNA-binding
Accession       S0028
Systematic name g.57585G>A, c.1268G>A, r.1268g>a, p.Arg423Gln
Original code   Family J016; Son
Description     A point mutation in the exon 13 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57585
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 13
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1508
Feature           /codon: cga -> caa; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 423
Feature           /change: R -> Q
Feature           /domain: DNA-binding
Sex             XY
Ethnic origin   Mongoloid
Family history  Inherited
Relative        STAT3base; S0027 father
Relative        STAT3base; S0029 sister
//
ID              R423Q(2c); standard; MUTATION; DNA-binding
Accession       S0029
Systematic name g.57585G>A, c.1268G>A, r.1268g>a, p.Arg423Gln
Original code   Family J016; Daughter
Description     A point mutation in the exon 13 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 57585
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 13
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1508
Feature           /codon: cga -> caa; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 423
Feature           /change: R -> Q
Feature           /domain: DNA-binding
Sex             XX
Ethnic origin   Mongoloid
Family history  Inherited
Relative        STAT3base; S0027 father
Relative        STAT3base; S0028 brother
//
ID              V432M(1); standard; MUTATION; DNA-binding
Accession       S0060
Systematic name g.60821G>A, c.1294G>A, r.1294g>a, p.Val432Met
Original code   HIES1
Description     A point mutation in the exon 14 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18591410
RefAuthors      Ma, C. S., Chew, G. Y., Simpson, N., Priyadarshi, A., 
RefAuthors      Wong, M., Grimbacher, B., Fulcher, D. A., Tangye, S. G., 
RefAuthors      Cook, M. C.
RefTitle        Deficiency of th17 cells in hyper igE syndrome due to 
RefTitle        mutations in STAT3.
RefLoc          J Exp Med:1551-1557 (2008)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 60821
Feature           /change: g -> a
Feature           /genomic_region: exon; 14
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1534
Feature           /codon: gtg -> atg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 432
Feature           /change: V -> M
Feature           /domain: DNA-binding
Symptoms        Candidiasis; Staphylococcus aureus pneumonia and abscesses;
Symptoms        parenchymal lung damage; fractures
Age             18
Sex             XY
//
ID              H437P(1); standard; MUTATION; DNA-binding
Accession       S0063
Systematic name g.60837A>C, c.1310A>C, r.1310a>c, p.His437Pro
Original code   HIES4
Description     A point mutation in the exon 14 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18591410
RefAuthors      Ma, C. S., Chew, G. Y., Simpson, N., Priyadarshi, A., 
RefAuthors      Wong, M., Grimbacher, B., Fulcher, D. A., Tangye, S. G., 
RefAuthors      Cook, M. C.
RefTitle        Deficiency of th17 cells in hyper igE syndrome due to 
RefTitle        mutations in STAT3.
RefLoc          J Exp Med:1551-1557 (2008)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 60837
Feature           /change: a -> c
Feature           /genomic_region: exon; 14
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1550
Feature           /codon: cac -> ccc; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 437
Feature           /change: H -> P
Feature           /domain: DNA-binding
Symptoms        Staphylococcus aureus abscesses; candidiasis
Age             7
Sex             XX
Family history  Inherited
//
ID              H437P(2); standard; MUTATION; DNA-binding
Accession       S0091
Systematic name g.60837A>C, c.1310A>C, r.1310a>c, p.His437Pro
Description     A point mutation in the exon 14 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 20490271
RefAuthors      Xie, L., Hu, X., Li, Y., Zhang, W., Chen, L.
RefTitle        Hyper-igE syndrome with STAT3 mutation: a case report in 
RefTitle        mainland china.
RefLoc          Clin Dev Immunol:289873 (2010)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 60837
Feature           /change: a -> c
Feature           /genomic_region: exon; 14
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1550
Feature           /codon: cac -> ccc; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 437
Feature           /change: H -> P
Feature           /domain: DNA-binding
Symptoms        Cough; Bloodu sputum; Boils on face and limbs; Eczema;
Symptoms        Recurrent pneumonia
IgE             37,700 IU/mL
Age             20
Sex             XY
Ethnic origin   China
//
ID              H437Y(1); standard; MUTATION; DNA-binding
Accession       S0004
Systematic name g.60836C>T, c.1309C>T, r.1309c>u, p.His437Tyr
Original code   Patient 5
Description     A point mutation in the exon 14 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Sep-2007 (Rel. 1, Created)
Date            13-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17676033
RefAuthors      Minegishi, Y., Saito, M., Tsuchiya, S., Tsuge, I., Takada, 
RefAuthors      H., Hara, T., Kawamura, N., Ariga, T., Pasic, S., 
RefAuthors      Stojkovic, O., Metin, A., Karasuyama, H.
RefTitle        Dominant-negative mutations in the DNA-binding domain of 
RefTitle        STAT3 cause hyper-igE syndrome.
RefLoc          Nature:1058-1062 (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 60836
Feature           /change: c -> t
Feature           /genomic_region: exon; 14
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1549
Feature           /codon: cac -> tac; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 437
Feature           /change: H -> Y
Feature           /domain: DNA-binding
Age             13
Sex             XX
Family history  De novo
//
ID              #V463-1(1); standard; MUTATION; DNA-binding
Accession       S0005
Systematic name g.61968_61970delGTG, c.1387_1389delGTG, r.1387_1389delgug,
Systematic name p.Val463del
Original code   Patient 1
Description     An inframe deletion in the exon 15 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Sep-2007 (Rel. 1, Created)
Date            13-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17676033
RefAuthors      Minegishi, Y., Saito, M., Tsuchiya, S., Tsuge, I., Takada, 
RefAuthors      H., Hara, T., Kawamura, N., Ariga, T., Pasic, S., 
RefAuthors      Stojkovic, O., Metin, A., Karasuyama, H.
RefTitle        Dominant-negative mutations in the DNA-binding domain of 
RefTitle        STAT3 cause hyper-igE syndrome.
RefLoc          Nature:1058-1062 (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0128: 61968..61970
Feature           /change: -gtg
Feature           /genomic_region: exon; 15
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: inframe deletion
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1627..1629
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: deletion; inframe
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 463
Feature           /change: -V
Feature           /domain: DNA-binding
Age             21
Sex             XX
Family history  De novo
//
ID              #V463-1(2); standard; MUTATION; DNA-binding
Accession       S0006
Systematic name g.61968_61970delGTG, c.1387_1389delGTG, r.1387_1389delgug,
Systematic name p.Val463del
Original code   Patient 3
Description     An inframe deletion in the exon 15 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Sep-2007 (Rel. 1, Created)
Date            13-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17676033
RefAuthors      Minegishi, Y., Saito, M., Tsuchiya, S., Tsuge, I., Takada, 
RefAuthors      H., Hara, T., Kawamura, N., Ariga, T., Pasic, S., 
RefAuthors      Stojkovic, O., Metin, A., Karasuyama, H.
RefTitle        Dominant-negative mutations in the DNA-binding domain of 
RefTitle        STAT3 cause hyper-igE syndrome.
RefLoc          Nature:1058-1062 (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0128: 61968..61970
Feature           /change: -gtg
Feature           /genomic_region: exon; 15
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: inframe deletion
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1627..1629
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: deletion; inframe
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 463
Feature           /change: -V
Feature           /domain: DNA-binding
Age             19
Sex             XY
Family history  De novo
//
ID              #V463-1(3); standard; MUTATION; DNA-binding
Accession       S0007
Systematic name g.61968_61970delGTG, c.1387_1389delGTG, r.1387_1389delgug,
Systematic name p.Val463del
Original code   Patient 8
Description     An inframe deletion in the exon 15 leading to an amino acid
Description     change in the DNA-binding domain
Date            13-Sep-2007 (Rel. 1, Created)
Date            13-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17676033
RefAuthors      Minegishi, Y., Saito, M., Tsuchiya, S., Tsuge, I., Takada, 
RefAuthors      H., Hara, T., Kawamura, N., Ariga, T., Pasic, S., 
RefAuthors      Stojkovic, O., Metin, A., Karasuyama, H.
RefTitle        Dominant-negative mutations in the DNA-binding domain of 
RefTitle        STAT3 cause hyper-igE syndrome.
RefLoc          Nature:1058-1062 (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0128: 61968..61970
Feature           /change: -gtg
Feature           /genomic_region: exon; 15
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: inframe deletion
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1627..1629
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: deletion; inframe
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 463
Feature           /change: -V
Feature           /domain: DNA-binding
Age             6
Sex             XY
Family history  De novo
//
ID              #V463-1(4); standard; MUTATION; DNA-binding
Accession       S0023
Systematic name g.61968_61970delGTG, c.1387_1389delGTG, r.1387_1389delgug,
Systematic name p.Val463del
Original code   Family J012; Proband
Description     An inframe deletion in the exon 15 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0128: 61968..61970
Feature           /change: -gtg
Feature           /genomic_region: exon; 15
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: inframe deletion
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1627..1629
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: deletion; inframe
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 463
Feature           /change: -V
Feature           /domain: DNA-binding
Ethnic origin   Caucasoid
Family history  Sporadic
//
ID              #V463-1(5a); standard; MUTATION; DNA-binding
Accession       S0050
Systematic name g.61968_61970delGTG, c.1387_1389delGTG, r.1387_1389delgug,
Systematic name p.Val463del
Original code   Family J087; Proband
Description     An inframe deletion in the exon 15 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0128: 61968..61970
Feature           /change: -gtg
Feature           /genomic_region: exon; 15
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: inframe deletion
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1627..1629
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: deletion; inframe
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 463
Feature           /change: -V
Feature           /domain: DNA-binding
Ethnic origin   Caucasoid
Family history  Sporadic
Relative        STAT3base; S0051 daughter
//
ID              #V463-1(5b); standard; MUTATION; DNA-binding
Accession       S0051
Systematic name g.61968_61970delGTG, c.1387_1389delGTG, r.1387_1389delgug,
Systematic name p.Val463del
Original code   Family J087; Daughter
Description     An inframe deletion in the exon 15 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0128: 61968..61970
Feature           /change: -gtg
Feature           /genomic_region: exon; 15
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: inframe deletion
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1627..1629
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: deletion; inframe
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 463
Feature           /change: -V
Feature           /domain: DNA-binding
Ethnic origin   Caucasoid
Family history  Inherited
Relative        STAT3base; S0050 parent
//
ID              S465A(1); standard; MUTATION; DNA-binding
Accession       S0044
Systematic name g.61974T>G, c.1393T>G, r.1393u>g, p.Ser465Ala
Original code   Family J054; Proband
Description     A point mutation in the exon 15 leading to an amino acid
Description     change in the DNA-binding domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 61974
Feature           /change: t -> g
Feature           /genomic_region: exon; 15
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1633
Feature           /codon: tcc -> gcc; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 465
Feature           /change: S -> A
Feature           /domain: DNA-binding
Ethnic origin   Caucasoid
Family history  Sporadic
//
ID              K531E(1); standard; MUTATION; Linker
Accession       S0090
Systematic name g.62288A>G, c.1591A>G, r.1591a>g, p.Lys531Glu
Description     A point mutation in the exon 16 leading to an amino acid
Description     change in the Linker domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 19348930
RefAuthors      Kim, H. J., Kim, J. H., Shin, Y. K., Lee, S. I., Ahn, K. 
RefAuthors      M.
RefTitle        A novel mutation in the linker domain of the signal 
RefTitle        transducer and activator of transcription 3 gene, 
RefTitle        p.lys531Glu, in hyper-igE syndrome.
RefLoc          J Allergy Clin Immunol:956-958 (2009)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 62288
Feature           /change: a -> g
Feature           /genomic_region: exon; 16
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 1831
Feature           /codon: aaa -> gaa; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 531
Feature           /change: K -> E
Feature           /domain: Linker
Symptoms        Fever; Cough; Otorrhea; Dermatitis; Cervical lymphadenitis;
Symptoms        Candidiasis; Otitis media
Age             5
Sex             XY
Ethnic origin   Korea
//
ID              S611N(1); standard; MUTATION; SH2
Accession       S0019
Systematic name g.63948G>A, c.1832G>A, r.1832g>a, p.Ser611Asn
Original code   Family J009; Proband
Description     A point mutation in the exon 19 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 63948
Feature           /change: g -> a
Feature           /genomic_region: exon; 19
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2072
Feature           /codon: agt -> aat; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 611
Feature           /change: S -> N
Feature           /domain: SH2
Ethnic origin   Caucasoid
Family history  Sporadic
//
ID              F621L(1); standard; MUTATION; SH2
Accession       S0083
Systematic name g.63979C>G, c.1863C>G, r.1863c>g, p.Phe621Leu
Original code   4-1
Description     A point mutation in the exon 19 leading to an amino acid
Description     change in the SH2 domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 20093388
RefAuthors      Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine, 
RefAuthors      N. H., Leppert, M. F., Carey, J. C., Ochs, H. D., 
RefAuthors      Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle        Rapid molecular analysis of the STAT3 gene in job syndrome 
RefTitle        of hyper-igE and recurrent infectious diseases.
RefLoc          J Mol Diagn:213-219 (2010)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 63979
Feature           /change: c -> g
Feature           /genomic_region: exon; 19
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2103
Feature           /codon: ttc -> ttg; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 621
Feature           /change: F -> L
Feature           /domain: SH2
Symptoms        Eczema; Abscess; Candidiasis
IgE             9,477 IU/ml
Sex             XX
Family history  Not known
//
ID              F621V(1); standard; MUTATION; SH2
Accession       S0026
Systematic name g.63977T>G, c.1861T>G, r.1861u>g, p.Phe621Val
Original code   Family J015; Proband
Description     A point mutation in the exon 19 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 63977
Feature           /change: t -> g
Feature           /genomic_region: exon; 19
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2101
Feature           /codon: ttc -> gtc; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 621
Feature           /change: F -> V
Feature           /domain: SH2
Ethnic origin   Caucasoid
Family history  Sporadic
//
ID              T622I(1a); standard; MUTATION; SH2
Accession       S0011
Systematic name g.63981C>T, c.1865C>T, r.1865c>u, p.Thr622Ile
Original code   Family J002; Proband
Description     A point mutation in the exon 19 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 63981
Feature           /change: c -> t
Feature           /genomic_region: exon; 19
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2105
Feature           /codon: act -> att; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 622
Feature           /change: T -> I
Feature           /domain: SH2
Sex             XY
Ethnic origin   Caucasoid
Family history  De novo
Relative        STAT3base; S0012 daughter
//
ID              T622I(1b); standard; MUTATION; SH2
Accession       S0012
Systematic name g.63981C>T, c.1865C>T, r.1865c>u, p.Thr622Ile
Original code   Family J002; Daughter
Description     A point mutation in the exon 19 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 63981
Feature           /change: c -> t
Feature           /genomic_region: exon; 19
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2105
Feature           /codon: act -> att; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 622
Feature           /change: T -> I
Feature           /domain: SH2
Sex             XX
Ethnic origin   Caucasoid
Family history  Inherited
Relative        STAT3base; S0011 father
//
ID              V637L(1); standard; MUTATION; SH2
Accession       S0053
Systematic name g.64534G>T, c.1909G>T, r.1909g>u, p.Val637Leu
Original code   Family J098; Proband
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64534
Feature           /change: g -> t
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature           /codon: gtg -> ttg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature           /change: V -> L
Feature           /domain: SH2
Ethnic origin   Caucasoid
Family history  Sporadic
//
ID              V637M(1a); standard; MUTATION; SH2
Accession       S0021
Systematic name g.64534G>A, c.1909G>A, r.1909g>a, p.Val637Met
Original code   Family J011; Proband
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64534
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature           /codon: gtg -> atg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature           /change: V -> M
Feature           /domain: SH2
Ethnic origin   Caucasoid
Family history  Inherited
Relative        STAT3base; S0022 sister
//
ID              V637M(1b); standard; MUTATION; SH2
Accession       S0022
Systematic name g.64534G>A, c.1909G>A, r.1909g>a, p.Val637Met
Original code   Family J011; Sister
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64534
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature           /codon: gtg -> atg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature           /change: V -> M
Feature           /domain: SH2
Sex             XX
Ethnic origin   Caucasoid
Family history  Inherited
Relative        STAT3base; S0021 sibling
//
ID              V637M(2); standard; MUTATION; SH2
Accession       S0025
Systematic name g.64534G>A, c.1909G>A, r.1909g>a, p.Val637Met
Original code   Family J014; Proband
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64534
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature           /codon: gtg -> atg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature           /change: V -> M
Feature           /domain: SH2
Sex             XX
Ethnic origin   Caucasoid
Family history  De novo
//
ID              V637M(3); standard; MUTATION; SH2
Accession       S0035
Systematic name g.64534G>A, c.1909G>A, r.1909g>a, p.Val637Met
Original code   Family J022; Proband
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64534
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature           /codon: gtg -> atg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature           /change: V -> M
Feature           /domain: SH2
Ethnic origin   Caucasoid
Family history  Sporadic
//
ID              V637M(4a); standard; MUTATION; SH2
Accession       S0040
Systematic name g.64534G>A, c.1909G>A, r.1909g>a, p.Val637Met
Original code   Family J035; Proband
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64534
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature           /codon: gtg -> atg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature           /change: V -> M
Feature           /domain: SH2
Sex             XY
Ethnic origin   Caucasoid
Family history  Sporadic
Relative        STAT3base; S0041 daughter
//
ID              V637M(4b); standard; MUTATION; SH2
Accession       S0041
Systematic name g.64534G>A, c.1909G>A, r.1909g>a, p.Val637Met
Original code   Family J035; Daughter
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64534
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature           /codon: gtg -> atg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature           /change: V -> M
Feature           /domain: SH2
Sex             XX
Ethnic origin   Caucasoid
Family history  Inherited
Relative        STAT3base; S0040 father
//
ID              V637M(5); standard; MUTATION; SH2
Accession       S0049
Systematic name g.64534G>A, c.1909G>A, r.1909g>a, p.Val637Met
Original code   Family J083; Proband
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64534
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature           /codon: gtg -> atg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature           /change: V -> M
Feature           /domain: SH2
Ethnic origin   Caucasoid
Family history  Sporadic
//
ID              V637M(6); standard; MUTATION; SH2
Accession       S0054
Systematic name g.64534G>A, c.1909G>A, r.1909g>a, p.Val637Met
Original code   Family J100; Proband
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64534
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature           /codon: gtg -> atg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature           /change: V -> M
Feature           /domain: SH2
Ethnic origin   Hispanic
Family history  Sporadic
//
ID              V637M(7); standard; MUTATION; SH2
Accession       S0073
Systematic name g.64534G>A, c.1909G>A, r.1909g>a, p.Val637Met
Original code   CA1
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18706697
RefAuthors      Jiao, H., Toth, B., Erdos, M., Fransson, I., Rakoczi, E., 
RefAuthors      Balogh, I., Magyarics, Z., Derfalvi, B., Csorba, G., 
RefAuthors      Szaflarska, A., Megarbane, A., Akatcherian, C., Dbaibo, 
RefAuthors      G., Rajnavolgyi, E., Hammarstrom, L., Kere, J., Lefranc, 
RefAuthors      G., Marodi, L.
RefTitle        Novel and recurrent STAT3 mutations in hyper-igE syndrome 
RefTitle        patients from different ethnic groups.
RefLoc          Mol Immunol:202-206 (2008)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64534
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature           /codon: gtg -> atg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature           /change: V -> M
Feature           /domain: SH2
Symptoms        Severe eczema; Skin abscess; Dental infections; Otitis;
Symptoms        Candidiasis; Pneumonia; Pneumatocele; Pectus exacavatum
Age             22
Sex             XY
Ethnic origin   Lebanon
//
ID              V637M(8); standard; MUTATION; SH2
Accession       S0074
Systematic name g.64534G>A, c.1909G>A, r.1909g>a, p.Val637Met
Original code   B
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18706697
RefAuthors      Jiao, H., Toth, B., Erdos, M., Fransson, I., Rakoczi, E., 
RefAuthors      Balogh, I., Magyarics, Z., Derfalvi, B., Csorba, G., 
RefAuthors      Szaflarska, A., Megarbane, A., Akatcherian, C., Dbaibo, 
RefAuthors      G., Rajnavolgyi, E., Hammarstrom, L., Kere, J., Lefranc, 
RefAuthors      G., Marodi, L.
RefTitle        Novel and recurrent STAT3 mutations in hyper-igE syndrome 
RefTitle        patients from different ethnic groups.
RefLoc          Mol Immunol:202-206 (2008)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64534
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2149
Feature           /codon: gtg -> atg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 637
Feature           /change: V -> M
Feature           /domain: SH2
Symptoms        Moderate eczema; Candidiasis; Conjunctivitis; Otitis;
Symptoms        Pyodermia; Candidiasis; Pneumonia; Face of job
Age             3
Sex             XX
Ethnic origin   Poland
//
ID              E638G(1); standard; MUTATION; SH2
Accession       S0082
Systematic name g.64538A>G, c.1913A>G, r.1913a>g, p.Glu638Gly
Original code   3-1
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 20093388
RefAuthors      Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine, 
RefAuthors      N. H., Leppert, M. F., Carey, J. C., Ochs, H. D., 
RefAuthors      Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle        Rapid molecular analysis of the STAT3 gene in job syndrome 
RefTitle        of hyper-igE and recurrent infectious diseases.
RefLoc          J Mol Diagn:213-219 (2010)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64538
Feature           /change: a -> g
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2153
Feature           /codon: gaa -> gga; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 638
Feature           /change: E -> G
Feature           /domain: SH2
Symptoms        Eczema; Abscess; Pneumonia; Candidiasis
IgE             3,206 IU/ml
Sex             XY
Family history  De novo
//
ID              P639A(1); standard; MUTATION; SH2
Accession       S0043
Systematic name g.64540C>G, c.1915C>G, r.1915c>g, p.Pro639Ala
Original code   Family J053; Proband
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64540
Feature           /change: c -> g
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2155
Feature           /codon: cca -> gca; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 639
Feature           /change: P -> A
Feature           /domain: SH2
Ethnic origin   Caucasoid
Family history  Sporadic
//
ID              Q644P(1); standard; MUTATION; SH2
Accession       S0064
Systematic name g.64556A>C, c.1931A>C, r.1931a>c, p.Gln644Pro
Original code   HIES5
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            13-Jul-2010 (Rel. 1, Created)
Date            13-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18591410
RefAuthors      Ma, C. S., Chew, G. Y., Simpson, N., Priyadarshi, A., 
RefAuthors      Wong, M., Grimbacher, B., Fulcher, D. A., Tangye, S. G., 
RefAuthors      Cook, M. C.
RefTitle        Deficiency of th17 cells in hyper igE syndrome due to 
RefTitle        mutations in STAT3.
RefLoc          J Exp Med:1551-1557 (2008)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64556
Feature           /change: a -> c
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2171
Feature           /codon: cag -> ccg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 644
Feature           /change: Q -> P
Feature           /domain: SH2
Symptoms        Staphylococcus aureus pneumonia and abscesses; candidiasis;
Symptoms        parenchymal lung damage; retained primary teeth
Age             42
Sex             XX
//
ID              #Q644-1(1); standard; MUTATION; SH2
Accession       S0058
Systematic name g.64555_64557delCAG, c.1930_1932delCAG, r.1930_1932delcag,
Systematic name p.Gln644del
Original code   Family J121; Proband
Description     An inframe deletion in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0128: 64555..64557
Feature           /change: -cag
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: inframe deletion
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2170..2172
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: deletion; inframe
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 644
Feature           /change: -Q
Feature           /domain: SH2
Ethnic origin   Caucasoid
Family history  Sporadic
//
ID              N647D(1a); standard; MUTATION; SH2
Accession       S0036
Systematic name g.64564A>G, c.1939A>G, r.1939a>g, p.Asn647Asp
Original code   Family J029; Proband
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64564
Feature           /change: a -> g
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2179
Feature           /codon: aac -> gac; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 647
Feature           /change: N -> D
Feature           /domain: SH2
Ethnic origin   Caucasoid
Family history  Inherited
Relative        STAT3base; S0037 sister
Relative        STAT3base; S0038 niece
//
ID              N647D(1b); standard; MUTATION; SH2
Accession       S0037
Systematic name g.64564A>G, c.1939A>G, r.1939a>g, p.Asn647Asp
Original code   Family J029; Sister
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64564
Feature           /change: a -> g
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2179
Feature           /codon: aac -> gac; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 647
Feature           /change: N -> D
Feature           /domain: SH2
Sex             XX
Ethnic origin   Caucasoid
Family history  Inherited
Relative        STAT3base; S0036 sibling
Relative        STAT3base; S0038
//
ID              N647D(1c); standard; MUTATION; SH2
Accession       S0038
Systematic name g.64564A>G, c.1939A>G, r.1939a>g, p.Asn647Asp
Original code   Family J029; Niece
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64564
Feature           /change: a -> g
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2179
Feature           /codon: aac -> gac; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 647
Feature           /change: N -> D
Feature           /domain: SH2
Sex             XX
Ethnic origin   Caucasoid
Family history  Inherited
Relative        STAT3base; S0036 aunt
Relative        STAT3base; S0037
//
ID              E652K(1a); standard; MUTATION; SH2
Accession       S0046
Systematic name g.64579G>A, c.1954G>A, r.1954g>a, p.Glu652Lys
Original code   Family J074; Proband
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64579
Feature           /change: g -> a
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2194
Feature           /codon: gaa -> aaa; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 652
Feature           /change: E -> K
Feature           /domain: SH2
Sex             XX
Ethnic origin   Caucasoid
Family history  Sporadic
Relative        STAT3base; S0047 daughter
Relative        STAT3base; S0048 daughter
//
ID              E652K(1b); standard; MUTATION; SH2
Accession       S0047
Systematic name g.64579G>A, c.1954G>A, r.1954g>a, p.Glu652Lys
Original code   Family J074; Daughter
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64579
Feature           /change: g -> a
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2194
Feature           /codon: gaa -> aaa; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 652
Feature           /change: E -> K
Feature           /domain: SH2
Sex             XX
Ethnic origin   Caucasoid
Family history  Inherited
Relative        STAT3base; S0046 mother
Relative        STAT3base; S0048 sister
//
ID              E652K(1c); standard; MUTATION; SH2
Accession       S0048
Systematic name g.64579G>A, c.1954G>A, r.1954g>a, p.Glu652Lys
Original code   Family J074; Daughter
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64579
Feature           /change: g -> a
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2194
Feature           /codon: gaa -> aaa; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 652
Feature           /change: E -> K
Feature           /domain: SH2
Sex             XX
Ethnic origin   Caucasoid
Family history  Inherited
Relative        STAT3base; S0046 mother
Relative        STAT3base; S0047 sister
//
ID              Y657C(1a); standard; MUTATION; SH2
Accession       S0055
Systematic name g.64595A>G, c.1970A>G, r.1970a>g, p.Tyr657Cys
Original code   Family J112; Proband
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64595
Feature           /change: a -> g
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2210
Feature           /codon: tat -> tgt; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 657
Feature           /change: Y -> C
Feature           /domain: SH2
Ethnic origin   Caucasoid
Family history  Sporadic
Relative        STAT3base; S0056 son
//
ID              Y657C(1b); standard; MUTATION; SH2
Accession       S0056
Systematic name g.64595A>G, c.1970A>G, r.1970a>g, p.Tyr657Cys
Original code   Family J112; Son
Description     A point mutation in the exon 20 leading to an amino acid
Description     change in the SH2 domain
Date            21-Sep-2007 (Rel. 1, Created)
Date            21-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17881745
RefAuthors      Holland, S. M., Deleo, F. R., Elloumi, H. Z., Hsu, A. P., 
RefAuthors      Uzel, G., Brodsky, N., Freeman, A. F., Demidowich, A., 
RefAuthors      Davis, J., Turner, M. L., Anderson, V. L., Darnell, D. N., 
RefAuthors      Welch, P. A., Kuhns, D. B., Frucht, D. M., Malech, H. L., 
RefAuthors      Gallin, J. I., Kobayashi, S. D., Whitney, A. R., Voyich, 
RefAuthors      J. M., Musser, J. M., Woellner, C., Schaffer, A. A., Puck, 
RefAuthors      J. M., Grimbacher, B.
RefTitle        STAT3 mutations in the hyper-igE syndrome.
RefLoc          N Engl J Med:S (2007)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0128: 64595
Feature           /change: a -> g
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2210
Feature           /codon: tat -> tgt; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 657
Feature           /change: Y -> C
Feature           /domain: SH2
Ethnic origin   Caucasoid
Family history  Inherited
Relative        STAT3base; S0055 parent
//
ID              #E690-10(1a); standard; MUTATION; Transactivation
Accession       S0092
Systematic name g.64694_64723delAGAGCCAGGAGCATCCTGAAGCTGACCCAG,
Systematic name c.2069_2098delAGAGCCAGGAGCATCCTGAAGCTGACCCAG,
Systematic name r.2069_2098delagagccaggagcauccugaagcugacccag, p.Glu690del
Original code   7-1
Description     An inframe deletion in the exon 20 leading to an amino acid
Description     change in the Transactivation domain
Date            03-Aug-2010 (Rel. 1, Created)
Date            03-Aug-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 20093388
RefAuthors      Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine, 
RefAuthors      N. H., Leppert, M. F., Carey, J. C., Ochs, H. D., 
RefAuthors      Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle        Rapid molecular analysis of the STAT3 gene in job syndrome 
RefTitle        of hyper-igE and recurrent infectious diseases.
RefLoc          J Mol Diagn:213-219 (2010)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0128: 64694..64723
Feature           /change: -agagccagga gcatcctgaa gctgacccag
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: inframe deletion
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2309..2338
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: deletion; inframe
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 690..700
Feature           /change: ESQEHPEADP G -> G
Feature           /domain: Transactivation
Symptoms        ECzema; Abscess; Pneumonia; Candida infection;
IgE             8127 IU/ml
Sex             XY
Family history  De novo
Relative        STAT3base; S0093 unknown
Relative        STAT3base; S0094 unknown
//
ID              #E690-10(1b); standard; MUTATION; Transactivation
Accession       S0093
Systematic name g.64694_64723delAGAGCCAGGAGCATCCTGAAGCTGACCCAG,
Systematic name c.2069_2098delAGAGCCAGGAGCATCCTGAAGCTGACCCAG,
Systematic name r.2069_2098delagagccaggagcauccugaagcugacccag, p.Glu690del
Original code   7-2
Description     An inframe deletion in the exon 20 leading to an amino acid
Description     change in the Transactivation domain
Date            03-Aug-2010 (Rel. 1, Created)
Date            03-Aug-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 20093388
RefAuthors      Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine, 
RefAuthors      N. H., Leppert, M. F., Carey, J. C., Ochs, H. D., 
RefAuthors      Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle        Rapid molecular analysis of the STAT3 gene in job syndrome 
RefTitle        of hyper-igE and recurrent infectious diseases.
RefLoc          J Mol Diagn:213-219 (2010)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0128: 64694..64723
Feature           /change: -agagccagga gcatcctgaa gctgacccag
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: inframe deletion
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2309..2338
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: deletion; inframe
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 690..700
Feature           /change: ESQEHPEADP G -> G
Feature           /domain: Transactivation
Symptoms        ECzema; Abscess; Pneumonia; Candida infection;
IgE             1293 IU/ml
Sex             XX
Family history  Inherited
Relative        STAT3base; S0092 unknown
Relative        STAT3base; S0094 unknown
//
ID              #E690-10(1c); standard; MUTATION; Transactivation
Accession       S0094
Systematic name g.64694_64723delAGAGCCAGGAGCATCCTGAAGCTGACCCAG,
Systematic name c.2069_2098delAGAGCCAGGAGCATCCTGAAGCTGACCCAG,
Systematic name r.2069_2098delagagccaggagcauccugaagcugacccag, p.Glu690del
Original code   7-3
Description     An inframe deletion in the exon 20 leading to an amino acid
Description     change in the Transactivation domain
Date            03-Aug-2010 (Rel. 1, Created)
Date            03-Aug-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 20093388
RefAuthors      Kumanovics, A., Wittwer, C. T., Pryor, R. J., Augustine, 
RefAuthors      N. H., Leppert, M. F., Carey, J. C., Ochs, H. D., 
RefAuthors      Wedgwood, R. J., Faville, R. J., Quie, P. G., Hill, H. R.
RefTitle        Rapid molecular analysis of the STAT3 gene in job syndrome 
RefTitle        of hyper-igE and recurrent infectious diseases.
RefLoc          J Mol Diagn:213-219 (2010)
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0128: 64694..64723
Feature           /change: -agagccagga gcatcctgaa gctgacccag
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: inframe deletion
Feature           /loc: IDRefSeq: C0128; ; STAT3C: 2309..2338
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: deletion; inframe
Feature           /loc: UniProt: P40763; STAT3_HUMAN: 690..700
Feature           /change: ESQEHPEADP G -> G
Feature           /domain: Transactivation
Symptoms        ECzema; Abscess; Pneumonia; Candida infection;
IgE             1909 IU/ml
Sex             XX
Family history  Inherited
Relative        STAT3base; S0092 unknown
Relative        STAT3base; S0093 unknown
//