Database SMARCAL1base
Version 1.1
File smarcal1pub.html
Date 16-Jun-2011
Curator Mauno Vihinen
Address Protein Structure and Bioinformatics
Address Lund University, BMC D10, SE-22184 Lund, Sweden
Phone +46 72 526 0022
Fax +46 46 222 9328
Email Mauno Vihinen
URL http://structure.bmc.lu.se/idbase/SMARCAL1base/
IDR factfile http://structure.bmc.lu.se/idbase/IDRefSeq/xml/idr/ff/FF148.html
Gene SMARCAL1
Disease Schimke immuno-osseous dysplasia
OMIM 606622
GDB 10796078
Sequence IDRefSeq:D0079; IDRefSeq:C0079; UniProt:Q9NZC9
Numbering start of the entry
Funding Tampere University Hospital Medical Research Fund
Funding European Union
Comments sequence entry reference in every entry
//
ID M1I(1),R561H(1); standard; MUTATION;
Accession S0043
Systematic name Allele 1: g.1003G>A, c.3G>A, r.3g>a, p.Met1Ile
Systematic name Allele 2: g.24753G>A, c.1682G>A, r.1682g>a, p.Arg561His
Description Allele 1: A point mutation in the exon 2 leading to an
Description amino acid change
Description Allele 2: A point mutation in the exon 9 leading to an
Description amino acid change
Date 27-Jul-2010 (Rel. 1, Created)
Date 27-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20179009
RefAuthors Yue, Z., Xiong, S., Sun, L., Huang, W., Mo, Y., Huang, L.,
RefAuthors Jiang, X., Chen, S., Hu, B., Wang, Y.
RefTitle Novel compound mutations of SMARCAL1 associated with
RefTitle severe schimke immuno-osseous dysplasia in a chinese
RefTitle patient.
RefLoc Nephrol Dial Transplant:1697-1702 (2010)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 1003
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 143
Feature /codon: atg -> ata; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 1
Feature /change: M -> I
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 24753
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 9
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 1822
Feature /codon: cgc -> cac; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 561
Feature /change: R -> H
Symptoms Growth retardation; Recurrent infections; Intermittent
Symptoms lymphopenia; Neutropenia; Anaemia;Proteinuria; Oedema;
Age 2.6
Sex XY
Ethnic origin China
Parents Non-consanguineous
Comment Patient's mother had hyperthyroidism.
//
ID R17X(1),Q34X(1); standard; MUTATION;
Accession S0006
Systematic name Allele 1: g.1049C>T, c.49C>T, r.49c>u, p.Arg17X
Systematic name Allele 2: g.1100C>T, c.100C>T, r.100c>u, p.Gln34X
Original code Pedigree 25
Description Allele 1: a point mutation in the exon 2 leading to a
Description premature stop codon
Description Allele 2: a point mutation in the exon 2 leading to a
Description premature stop codon
Date 03-Sep-2004 (Rel. 1, Created)
Date 03-Sep-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11799392
RefAuthors Boerkoel, C. F., Takashima, H., John, J., Yan, J.,
RefAuthors Stankiewicz, P., Rosenbarker, L., Andre, J. L.,
RefAuthors Bogdanovic, R., Burguet, A., Cockfield, S., Cordeiro, I.,
RefAuthors Frund, S., Illies, F., Joseph, M., Kaitila, I., Lama, G.,
RefAuthors Loirat, C., McLeod, D. R., Milford, D. V., Petty, E. M.,
RefAuthors Rodrigo, F., Saraiva, J. M., Schmidt, B., Smith, G. C.,
RefAuthors Spranger, J., Stein, A., Thiele, H., Tizard, J.,
RefAuthors Weksberg, R., Lupski, J. R., Stockton, D. W.
RefTitle Mutant chromatin remodeling protein SMARCAL1 causes
RefTitle schimke immuno-osseous dysplasia.
RefLoc Nat Genet 30:215-220 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 1049
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079: 189
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 17
Feature /change: R -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 1100
Feature /change: c -> t
Feature /genomic_region: exon; 2
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079: 240
Feature /codon: cag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 34
Feature /change: Q -> X
Symptoms sphondyloepiphyseal dysplasia, dysmorphic facial features
Symptoms and hyperpigmented macules that occur predominantly on the
Symptoms trunk, renal disease, lymphocytopenia, recurrent
Symptoms infections, central nervous system symptoms
Sex XX
Ethnic origin Caucasoid; Wales
//
ID @P113X117(1),?; standard; MUTATION;
Accession S0032
Systematic name Allele 1: g.1338_1339insAGTCCAC, c.338_339insAGTCCAC,
Systematic name r.338_339insaguccac, p.Arg114fsX4
Description Allele 1: A frame shift insertion mutation in the exon 2
Description leading to a premature stop codon
Date 02-Jun-2008 (Rel. 1, Created)
Date 02-Jun-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17089404
RefAuthors Clewing, J. M., Fryssira, H., Goodman, D., Smithson, S.
RefAuthors F., Sloan, E. A., Lou, S., Huang, Y., Choi, K., Lucke, T.,
RefAuthors Alpay, H., Andre, J. L., Asakura, Y., Biebuyck-Gouge, N.,
RefAuthors Bogdanovic, R., Bonneau, D., Cancrini, C., Cochat, P.,
RefAuthors Cockfield, S., Collard, L., Cordeiro, I., Cormier-Daire,
RefAuthors V., Cransberg, K., Cutka, K., Deschenes, G., Ehrich, J.
RefAuthors H., Frund, S., Georgaki, H., Guillen-Navarro, E.,
RefAuthors Hinkelmann, B., Kanariou, M., Kasap, B., Kilic, S. S.,
RefAuthors Lama, G., Lamfers, P., Loirat, C., Majore, S., Milford,
RefAuthors D., Morin, D., Ozdemir, N., Pontz, B. F., Proesmans, W.,
RefAuthors Psoni, S., Reichenbach, H., Reif, S., Rusu, C., Saraiva,
RefAuthors J. M., Sakallioglu, O., Schmidt, B., Shoemaker, L.,
RefAuthors Sigaudy, S., Smith, G., Sotsiou, F., Stajic, N., Stein,
RefAuthors A., Stray-Pedersen, A., Taha, D., Taque, S., Tizard, J.,
RefAuthors Tsimaratos, M., Wong, N. A., Boerkoel, C. F.
RefTitle Schimke immunoosseous dysplasia: suggestions of genetic
RefTitle diversity.
RefLoc Hum Mutat:273-283 (2007)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0079: 1339
Feature /change: +agtccac
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 479
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 113
Feature /change: P -> PVHTX
Ethnic origin Caucasoid; Germany
//
ID @P113X117(2),F279S(3); standard; MUTATION; ,HARP1
Accession S0039
Systematic name Allele 1: g.1338_1339insAGTCCAC, c.338_339insAGTCCAC,
Systematic name r.338_339insaguccac, p.Arg114fsX4
Systematic name Allele 2: g.2577T>C, c.836T>C, r.836u>c, p.Phe279Ser
Original code P.2
Description Allele 1: A frame shift insertion mutation in the exon 2
Description leading to a premature stop codon
Description Allele 2: A point mutation in the exon 3 leading to an
Description amino acid change in the HARP1 domain
Date 26-Jul-2010 (Rel. 1, Created)
Date 26-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18785907
RefAuthors Lucke, T., Kanzelmeyer, N., Baradaran-Heravi, A.,
RefAuthors Boerkoel, C. F., Burg, M., Ehrich, J. H., Pape, L.
RefTitle Improved outcome with immunosuppressive monotherapy after
RefTitle renal transplantation in schimke-immuno-osseous dysplasia.
RefLoc Pediatr Transplant:482-489 (2009)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0079: 1339
Feature /change: +agtccac
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 479
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 113
Feature /change: P -> PVHTX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 2577
Feature /change: t -> c
Feature /genomic_region: exon; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 976
Feature /codon: ttc -> tcc; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 279
Feature /change: F -> S
Feature /domain: HARP1
Symptoms Pneumonia; Nephrotic syndrome; Hypertension; Cerebral
Symptoms ischemia; Bacterial infections;
Age 3.5
Sex XX
//
ID F279S(1a),E848X(5a); standard; MUTATION; HARP1,
Accession S0021
Systematic name Allele 1: g.2577T>C, c.836T>C, r.836u>c, p.Phe279Ser
Systematic name Allele 2: g.64512G>T, c.2542G>T, r.2542g>u, p.Glu848X
Original code Patient 1
Description Allele 1: a point mutation in the exon 3 leading to an
Description amino acid change in the HARP1 domain
Description Allele 2: a point mutation in the exon 16 leading to a
Description premature stop codon
Date 27-Jun-2005 (Rel. 1, Created)
Date 27-Jun-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15880370
RefAuthors Lucke, T., Billing, H., Sloan, E. A., Boerkoel, C. F.,
RefAuthors Franke, D., Zimmering, M., Ehrich, J. H., Das, A. M.
RefTitle Schimke-immuno-osseous dysplasia: new mutation with weak
RefTitle genotype-phenotype correlation in siblings.
RefLoc Am J Med Genet A 135:202-205 (2005)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 2577
Feature /change: t -> c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 976
Feature /codon: ttc -> tcc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 279
Feature /change: F -> S
Feature /domain: HARP1
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 64512
Feature /change: g -> t
Feature /genomic_region: exon; 16
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079: 2682
Feature /codon: gag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 848
Feature /change: E -> X
Symptoms hypertension, prolonged gastroenteritis with weakness and
Symptoms apathy, severe anemia, chronic renal failure
Sex XY
Ethnic origin Caucasoid; German
Parents Non-consanguineous
Relative SMARCAL1base; S0022 brother
//
ID F279S(1b),E848X(5b); standard; MUTATION; HARP1,
Accession S0022
Systematic name Allele 1: g.2577T>C, c.836T>C, r.836u>c, p.Phe279Ser
Systematic name Allele 2: g.64512G>T, c.2542G>T, r.2542g>u, p.Glu848X
Original code Patient 2
Description Allele 1: a point mutation in the exon 3 leading to an
Description amino acid change in the HARP1 domain
Description Allele 2: a point mutation in the exon 16 leading to a
Description premature stop codon
Date 27-Jun-2005 (Rel. 1, Created)
Date 27-Jun-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15880370
RefAuthors Lucke, T., Billing, H., Sloan, E. A., Boerkoel, C. F.,
RefAuthors Franke, D., Zimmering, M., Ehrich, J. H., Das, A. M.
RefTitle Schimke-immuno-osseous dysplasia: new mutation with weak
RefTitle genotype-phenotype correlation in siblings.
RefLoc Am J Med Genet A 135:202-205 (2005)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 2577
Feature /change: t -> c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 976
Feature /codon: ttc -> tcc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 279
Feature /change: F -> S
Feature /domain: HARP1
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 64512
Feature /change: g -> t
Feature /genomic_region: exon; 16
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079: 2682
Feature /codon: gag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 848
Feature /change: E -> X
Symptoms steroid-resistant nephrotic syndrome and hypertension,
Symptoms segmental glomerulosclerosis, transitory ischemic attacks
Symptoms characterized by weakness of his left arm and leg,
Symptoms dizziness, amnesia and difficulties with swallowing, short
Symptoms stature, lumbar lordosis and hyperpigmented macules, renal
Symptoms failure
Sex XY
Ethnic origin Caucasoid; German
Parents Non-consanguineous
Relative SMARCAL1base; S0021 brother
//
ID F279S(2),H379P(1); standard; MUTATION; HARP1,HARP2
Accession S0023
Systematic name Allele 1: g.2577T>C, c.836T>C, r.836u>c, p.Phe279Ser
Systematic name Allele 2: g.9968A>C, c.1136A>C, r.1136a>c, p.His379Pro
Original code 72
Description Allele 1: a point mutation in the exon 3 leading to an
Description amino acid change in the HARP1 domain
Description Allele 2: a point mutation in the exon 5 leading to an
Description amino acid change in the HARP2 domain
Date 27-Jun-2005 (Rel. 1, Created)
Date 27-Jun-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15884045
RefAuthors Kilic, S. S., Donmez, O., Sloan, E. A., Elizondo, L. I.,
RefAuthors Huang, C., Andre, J. L., Bogdanovic, R., Cockfield, S.,
RefAuthors Cordeiro, I., Deschenes, G., Frund, S., Kaitila, I., Lama,
RefAuthors G., Lamfers, P., Lucke, T., Milford, D. V., Najera, L.,
RefAuthors Rodrigo, F., Saraiva, J. M., Schmidt, B., Smith, G. C.,
RefAuthors Stajic, N., Stein, A., Taha, D., Wand, D., Armstrong, D.,
RefAuthors Boerkoel, C. F.
RefTitle Association of migraine-like headaches with schimke immuno-
RefTitle osseous dysplasia.
RefLoc Am J Med Genet A 135:206-210 (2005)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 2577
Feature /change: t -> c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 976
Feature /codon: ttc -> tcc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 279
Feature /change: F -> S
Feature /domain: HARP1
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 9968
Feature /change: a -> c
Feature /genomic_region: exon; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 1276
Feature /codon: cac -> ccc; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 379
Feature /change: H -> P
Feature /domain: HARP2
Symptoms typical SIOD, recurrent, severe, refractory migraine-like
Symptoms headaches every 3-4 months preceded by listlessness and
Symptoms followed by nausea, vomiting and photophobia
Sex XY
//
ID Q319X(1),Q319X(1); standard; MUTATION;
Accession S0019
Systematic name Allele 1 and 2: g.6687C>T, c.955C>T, r.955c>u, p.Gln319X
Original code Patient 570
Description Allele 1 and 2: a point mutation in the exon 4 leading to
Description a premature stop codon
Date 06-Sep-2004 (Rel. 1, Created)
Date 06-Sep-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12471207
RefAuthors Lou, S., Lamfers, P., McGuire, N., Boerkoel, C. F.
RefTitle Longevity in schimke immuno-osseous dysplasia.
RefLoc J Med Genet 39:922-925 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 6687
Feature /change: c -> t
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079: 1095
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 319
Feature /change: Q -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 6687
Feature /change: c -> t
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079: 1095
Feature /codon: cag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 319
Feature /change: Q -> X
Symptoms recurrent infections; otitis media, sinusitis,
Symptoms pharyngitis, bacterial pneumonia, mycoplasma pneumonia,
Symptoms gastroenteritis, herpes zoster, fungal skin infections,
Symptoms Epstein-Barr virus infection following renal
Symptoms transplantation, lymphopenia,
Symptoms neutropenia, anaemia, CNS symptoms
Sex XX
Parents Consanguineous
//
ID R334X(1),?; standard; MUTATION;
Accession S0031
Systematic name Allele 1: g.6732C>T, c.1000C>T, r.1000c>u, p.Arg334X
Description Allele 1: A point mutation in the exon 4 leading to a
Description premature stop codon
Date 02-Jun-2008 (Rel. 1, Created)
Date 02-Jun-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17089404
RefAuthors Clewing, J. M., Fryssira, H., Goodman, D., Smithson, S.
RefAuthors F., Sloan, E. A., Lou, S., Huang, Y., Choi, K., Lucke, T.,
RefAuthors Alpay, H., Andre, J. L., Asakura, Y., Biebuyck-Gouge, N.,
RefAuthors Bogdanovic, R., Bonneau, D., Cancrini, C., Cochat, P.,
RefAuthors Cockfield, S., Collard, L., Cordeiro, I., Cormier-Daire,
RefAuthors V., Cransberg, K., Cutka, K., Deschenes, G., Ehrich, J.
RefAuthors H., Frund, S., Georgaki, H., Guillen-Navarro, E.,
RefAuthors Hinkelmann, B., Kanariou, M., Kasap, B., Kilic, S. S.,
RefAuthors Lama, G., Lamfers, P., Loirat, C., Majore, S., Milford,
RefAuthors D., Morin, D., Ozdemir, N., Pontz, B. F., Proesmans, W.,
RefAuthors Psoni, S., Reichenbach, H., Reif, S., Rusu, C., Saraiva,
RefAuthors J. M., Sakallioglu, O., Schmidt, B., Shoemaker, L.,
RefAuthors Sigaudy, S., Smith, G., Sotsiou, F., Stajic, N., Stein,
RefAuthors A., Stray-Pedersen, A., Taha, D., Taque, S., Tizard, J.,
RefAuthors Tsimaratos, M., Wong, N. A., Boerkoel, C. F.
RefTitle Schimke immunoosseous dysplasia: suggestions of genetic
RefTitle diversity.
RefLoc Hum Mutat:273-283 (2007)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 6732
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 1140
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 334
Feature /change: R -> X
Ethnic origin Caucasoid; Germany
//
ID E377Q(1),?; standard; MUTATION; HARP2
Accession S0034
Systematic name Allele 1: g.9961G>C, c.1129G>C, r.1129g>c, p.Glu377Gln
Description Allele 1: A point mutation in the exon 5 leading to an
Description amino acid change in the HARP2 domain
Date 03-Jun-2008 (Rel. 1, Created)
Date 03-Jun-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17089404
RefAuthors Clewing, J. M., Fryssira, H., Goodman, D., Smithson, S.
RefAuthors F., Sloan, E. A., Lou, S., Huang, Y., Choi, K., Lucke, T.,
RefAuthors Alpay, H., Andre, J. L., Asakura, Y., Biebuyck-Gouge, N.,
RefAuthors Bogdanovic, R., Bonneau, D., Cancrini, C., Cochat, P.,
RefAuthors Cockfield, S., Collard, L., Cordeiro, I., Cormier-Daire,
RefAuthors V., Cransberg, K., Cutka, K., Deschenes, G., Ehrich, J.
RefAuthors H., Frund, S., Georgaki, H., Guillen-Navarro, E.,
RefAuthors Hinkelmann, B., Kanariou, M., Kasap, B., Kilic, S. S.,
RefAuthors Lama, G., Lamfers, P., Loirat, C., Majore, S., Milford,
RefAuthors D., Morin, D., Ozdemir, N., Pontz, B. F., Proesmans, W.,
RefAuthors Psoni, S., Reichenbach, H., Reif, S., Rusu, C., Saraiva,
RefAuthors J. M., Sakallioglu, O., Schmidt, B., Shoemaker, L.,
RefAuthors Sigaudy, S., Smith, G., Sotsiou, F., Stajic, N., Stein,
RefAuthors A., Stray-Pedersen, A., Taha, D., Taque, S., Tizard, J.,
RefAuthors Tsimaratos, M., Wong, N. A., Boerkoel, C. F.
RefTitle Schimke immunoosseous dysplasia: suggestions of genetic
RefTitle diversity.
RefLoc Hum Mutat:273-283 (2007)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 9961
Feature /change: g -> c
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 1269
Feature /codon: gaa -> caa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 377
Feature /change: E -> Q
Feature /domain: HARP2
Ethnic origin Caucasoid; France
//
ID R476Q(1),?; standard; MUTATION; ,HARP2
Accession S0035
Systematic name Allele 1: g.19106G>A, c.1427G>A, r.1427g>a, p.Arg476Gln
Description Allele 1: A point mutation in the exon 7 leading to an
Description amino acid change
Date 03-Jun-2008 (Rel. 1, Created)
Date 03-Jun-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17089404
RefAuthors Clewing, J. M., Fryssira, H., Goodman, D., Smithson, S.
RefAuthors F., Sloan, E. A., Lou, S., Huang, Y., Choi, K., Lucke, T.,
RefAuthors Alpay, H., Andre, J. L., Asakura, Y., Biebuyck-Gouge, N.,
RefAuthors Bogdanovic, R., Bonneau, D., Cancrini, C., Cochat, P.,
RefAuthors Cockfield, S., Collard, L., Cordeiro, I., Cormier-Daire,
RefAuthors V., Cransberg, K., Cutka, K., Deschenes, G., Ehrich, J.
RefAuthors H., Frund, S., Georgaki, H., Guillen-Navarro, E.,
RefAuthors Hinkelmann, B., Kanariou, M., Kasap, B., Kilic, S. S.,
RefAuthors Lama, G., Lamfers, P., Loirat, C., Majore, S., Milford,
RefAuthors D., Morin, D., Ozdemir, N., Pontz, B. F., Proesmans, W.,
RefAuthors Psoni, S., Reichenbach, H., Reif, S., Rusu, C., Saraiva,
RefAuthors J. M., Sakallioglu, O., Schmidt, B., Shoemaker, L.,
RefAuthors Sigaudy, S., Smith, G., Sotsiou, F., Stajic, N., Stein,
RefAuthors A., Stray-Pedersen, A., Taha, D., Taque, S., Tizard, J.,
RefAuthors Tsimaratos, M., Wong, N. A., Boerkoel, C. F.
RefTitle Schimke immunoosseous dysplasia: suggestions of genetic
RefTitle diversity.
RefLoc Hum Mutat:273-283 (2007)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 19106
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 1567
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 476
Feature /change: R -> Q
Ethnic origin Caucasoid; Turkey
//
ID E378X(1),E378X(1); standard; MUTATION;
Accession S0003
Systematic name Allele 1 and 2: g.9964G>T, c.1132G>T, r.1132g>u, p.Glu378X
Original code Pedigree 30; SD300
Description Allele 1 and 2: a point mutation in the exon 5 leading to
Description a premature stop codon
Date 03-Sep-2004 (Rel. 1, Created)
Date 03-Sep-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11799392
RefAuthors Boerkoel, C. F., Takashima, H., John, J., Yan, J.,
RefAuthors Stankiewicz, P., Rosenbarker, L., Andre, J. L.,
RefAuthors Bogdanovic, R., Burguet, A., Cockfield, S., Cordeiro, I.,
RefAuthors Frund, S., Illies, F., Joseph, M., Kaitila, I., Lama, G.,
RefAuthors Loirat, C., McLeod, D. R., Milford, D. V., Petty, E. M.,
RefAuthors Rodrigo, F., Saraiva, J. M., Schmidt, B., Smith, G. C.,
RefAuthors Spranger, J., Stein, A., Thiele, H., Tizard, J.,
RefAuthors Weksberg, R., Lupski, J. R., Stockton, D. W.
RefTitle Mutant chromatin remodeling protein SMARCAL1 causes
RefTitle schimke immuno-osseous dysplasia.
RefLoc Nat Genet 30:215-220 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 9964
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079: 1272
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 378
Feature /change: E -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 9964
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079: 1272
Feature /codon: gag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 378
Feature /change: E -> X
Symptoms sphondyloepiphyseal dysplasia, dysmorphic facial features
Symptoms and hyperpigmented macules that occur predominantly on the
Symptoms trunk, renal disease, lymphocytopenia, recurrent
Symptoms infections, central nervous system symptoms
Sex XX
Ethnic origin Caucasoid; Iraq
Parents Consanguineous
//
ID @T417X427(1),F702V(1); standard; MUTATION;
Accession S0027
Systematic name Allele 1: g.14992dupC, c.1248dupC, r.1248dupc,
Systematic name p.Thr417fsX11
Systematic name Allele 2: g.50926T>G, c.2104T>G, r.2104u>g, p.Phe702Val
Original code Patient 2, SD840 (Ref1)
Description Allele 1: A frame shift duplication mutation in the exon 6
Description leading to a premature stop codon
Description Allele 2: A point mutation in the exon 12 leading to an
Description amino acid change
Date 02-Jun-2008 (Rel. 1, Created)
Date 02-Jun-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16840568
RefAuthors Clewing, J. M., Antalfy, B. C., Lucke, T., Najafian, B.,
RefAuthors Marwedel, K. M., Hori, A., Powel, R. M., Do, A. F.,
RefAuthors Najera, L., SantaCruz, K., Hicks, M. J., Armstrong, D. L.,
RefAuthors Boerkoel, C. F.
RefTitle Schimke immuno-osseous dysplasia: a clinicopathological
RefTitle correlation.
RefLoc J Med Genet:122-130 (2007)
RefNumber [2]
RefCrossRef PUBMED; 15054643
RefAuthors Lucke, T., Marwedel, K. M., Kanzelmeyer, N. K., Hori, A.,
RefAuthors Offner, G., Kreipe, H. H., Ehrich, J. H., Das, A. M.
RefTitle Generalized atherosclerosis sparing the transplanted
RefTitle kidney in schimke disease.
RefLoc Pediatr Nephrol:672-675 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0079: 14993
Feature /change: +c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 1389
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 417
Feature /change: T -> HARCPRGRPF X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 50926
Feature /change: t -> g
Feature /genomic_region: exon; 12
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 2244
Feature /codon: ttc -> gtc; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 702
Feature /change: F -> V
Symptoms Lymphopenia, recurrent infections, circulating T cell
Symptoms deficiency, focal segmental glomerusclerosis (FSGS),
Symptoms progressive renal failure: renal transplant, hypertension
Symptoms before and after transplant; transient ischaemic attacks
Symptoms (TIA), migraines, pulmonary hypertension, dyspnoea, broad
Symptoms low nasal bridge, bulbous nasal tip, microdontia,
Symptoms hyperpigmented macules, lumbar lordosis, protuberant
Symptoms abdomen, poor growth, disproportionate short stature,
Symptoms sponduloepiphysial dysplasia, degenerative hip disease
Sex XY
Ethnic origin Germany
Parents Non-consanguineous
Comment deceased
//
ID A468P(1),T705I(1); standard; MUTATION;
Accession S0010
Systematic name Allele 1: g.19081G>C, c.1402G>C, r.1402g>c, p.Ala468Pro
Systematic name Allele 2: g.50936C>T, c.2114C>T, r.2114c>u, p.Thr705Ile
Original code Pedigree 39
Description Allele 1: a point mutation in the exon 7 leading to an
Description amino acid change
Description Allele 2: a point mutation in the exon 12 leading to an
Description amino acid change
Date 03-Sep-2004 (Rel. 1, Created)
Date 03-Sep-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11799392
RefAuthors Boerkoel, C. F., Takashima, H., John, J., Yan, J.,
RefAuthors Stankiewicz, P., Rosenbarker, L., Andre, J. L.,
RefAuthors Bogdanovic, R., Burguet, A., Cockfield, S., Cordeiro, I.,
RefAuthors Frund, S., Illies, F., Joseph, M., Kaitila, I., Lama, G.,
RefAuthors Loirat, C., McLeod, D. R., Milford, D. V., Petty, E. M.,
RefAuthors Rodrigo, F., Saraiva, J. M., Schmidt, B., Smith, G. C.,
RefAuthors Spranger, J., Stein, A., Thiele, H., Tizard, J.,
RefAuthors Weksberg, R., Lupski, J. R., Stockton, D. W.
RefTitle Mutant chromatin remodeling protein SMARCAL1 causes
RefTitle schimke immuno-osseous dysplasia.
RefLoc Nat Genet 30:215-220 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 19081
Feature /change: g -> c
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 1542
Feature /codon: gcc -> ccc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 468
Feature /change: A -> P
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 50936
Feature /change: c -> t
Feature /genomic_region: exon; 12
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 2254
Feature /codon: aca -> ata; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 705
Feature /change: T -> I
Symptoms dysmorphic facial features and hyperpigmented macules that
Symptoms occur predominantly on the trunk, renal disease,
Symptoms lymphocytopenia, recurrent infections, central nervous
Symptoms system symptoms
Sex XY
Ethnic origin Caucasoid; Germany
//
ID A468P(2),A468P(2); standard; MUTATION;
Accession S0029
Systematic name Allele 1 and 2: g.19081G>C, c.1402G>C, r.1402g>c,
Systematic name p.Ala468Pro
Description Allele 1 and 2: A point mutation in the exon 7 leading to
Description an amino acid change
Date 02-Jun-2008 (Rel. 1, Created)
Date 02-Jun-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17195070
RefAuthors Sauerstein, K., Schroth, M., Amann, K., Hoyer, J., Singer,
RefAuthors H., Rauch, A., Dotsch, J.
RefTitle Pulmonary embolism--a rare complication of schimke
RefTitle immunoosseous dysplasia.
RefLoc Eur J Pediatr:1285-1288 (2007)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 19081
Feature /change: g -> c
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 1542
Feature /codon: gcc -> ccc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 468
Feature /change: A -> P
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 19081
Feature /change: g -> c
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 1542
Feature /codon: gcc -> ccc; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 468
Feature /change: A -> P
Symptoms severe pulmonary embolism, a small placenta, a small VSD,
Symptoms bilateral pyelectasia,facial and pretibial oedema,
Symptoms nephrotic syndrome, anemia, lymphocytopenia, metacarpal
Symptoms pseudoepiphyses, short stature with hyperlordosis,
Symptoms disproportionate short trunk and neck, upslanting,
Symptoms palpebral fissures, broad nasal bridge, bulbous nasal tip,
Symptoms widely spaced teeth, extensive white lines on palmes and
Symptoms soles, clinodactyly, photophobia, proteinuria,
Symptoms hypervolemia, ascites and pleura effusion on the left side,
Symptoms dyspnea, syanosis, focal segmental sclerosis, fulminant
Symptoms respiratory insufficiency
Sex XX
Parents Consanguineous
//
ID P480L(1),?; standard; MUTATION;
Accession S0036
Systematic name Allele 1: g.19118C>T, c.1439C>T, r.1439c>u, p.Pro480Leu
Description Allele 1: A point mutation in the exon 7 leading to an
Description amino acid change
Date 03-Jun-2008 (Rel. 1, Created)
Date 03-Jun-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17089404
RefAuthors Clewing, J. M., Fryssira, H., Goodman, D., Smithson, S.
RefAuthors F., Sloan, E. A., Lou, S., Huang, Y., Choi, K., Lucke, T.,
RefAuthors Alpay, H., Andre, J. L., Asakura, Y., Biebuyck-Gouge, N.,
RefAuthors Bogdanovic, R., Bonneau, D., Cancrini, C., Cochat, P.,
RefAuthors Cockfield, S., Collard, L., Cordeiro, I., Cormier-Daire,
RefAuthors V., Cransberg, K., Cutka, K., Deschenes, G., Ehrich, J.
RefAuthors H., Frund, S., Georgaki, H., Guillen-Navarro, E.,
RefAuthors Hinkelmann, B., Kanariou, M., Kasap, B., Kilic, S. S.,
RefAuthors Lama, G., Lamfers, P., Loirat, C., Majore, S., Milford,
RefAuthors D., Morin, D., Ozdemir, N., Pontz, B. F., Proesmans, W.,
RefAuthors Psoni, S., Reichenbach, H., Reif, S., Rusu, C., Saraiva,
RefAuthors J. M., Sakallioglu, O., Schmidt, B., Shoemaker, L.,
RefAuthors Sigaudy, S., Smith, G., Sotsiou, F., Stajic, N., Stein,
RefAuthors A., Stray-Pedersen, A., Taha, D., Taque, S., Tizard, J.,
RefAuthors Tsimaratos, M., Wong, N. A., Boerkoel, C. F.
RefTitle Schimke immunoosseous dysplasia: suggestions of genetic
RefTitle diversity.
RefLoc Hum Mutat:273-283 (2007)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 19118
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 1579
Feature /codon: ccg -> ctg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 480
Feature /change: P -> L
Ethnic origin Caucasoid; Italy
//
ID I548N(1),R645C(1); standard; MUTATION;
Accession S0017
Systematic name Allele 1: g.21791T>A, c.1643T>A, r.1643u>a, p.Ile548Asn
Systematic name Allele 2: g.37223C>T, c.1933C>T, r.1933c>u, p.Arg645Cys
Original code Pedigree 16
Description Allele 1: a point mutation in the exon 8 leading to an
Description amino acid change
Description Allele 2: a point mutation in the exon 11 leading to an
Description amino acid change
Date 06-Sep-2004 (Rel. 1, Created)
Date 06-Sep-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11799392
RefAuthors Boerkoel, C. F., Takashima, H., John, J., Yan, J.,
RefAuthors Stankiewicz, P., Rosenbarker, L., Andre, J. L.,
RefAuthors Bogdanovic, R., Burguet, A., Cockfield, S., Cordeiro, I.,
RefAuthors Frund, S., Illies, F., Joseph, M., Kaitila, I., Lama, G.,
RefAuthors Loirat, C., McLeod, D. R., Milford, D. V., Petty, E. M.,
RefAuthors Rodrigo, F., Saraiva, J. M., Schmidt, B., Smith, G. C.,
RefAuthors Spranger, J., Stein, A., Thiele, H., Tizard, J.,
RefAuthors Weksberg, R., Lupski, J. R., Stockton, D. W.
RefTitle Mutant chromatin remodeling protein SMARCAL1 causes
RefTitle schimke immuno-osseous dysplasia.
RefLoc Nat Genet 30:215-220 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 21791
Feature /change: t -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 1783
Feature /codon: att -> aat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 548
Feature /change: I -> N
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 37223
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 11
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 2073
Feature /codon: cgc -> tgc; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 645
Feature /change: R -> C
Symptoms sphondyloepiphyseal dysplasia, dysmorphic facial features
Symptoms and hyperpigmented macules that occur predominantly on the
Symptoms trunk, renal disease, lymphocytopenia
Sex XY
Ethnic origin Caucasoid; Scotland/France
Comment Milder disease phenotype
//
ID R561C(1a),R561C(1a); standard; MUTATION;
Accession S0024
Systematic name Allele 1 and 2: g.24752C>T, c.1681C>T, r.1681c>u,
Systematic name p.Arg561Cys
Original code II.3
Description Allele 1 and 2: a point mutation in the exon 9 leading to
Description an amino acid change
Date 10-Jan-2006 (Rel. 1, Created)
Date 10-Jan-2006 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16237566
RefAuthors Bokenkamp, A., deJong, M., van Wijk, J. A., Block, D., van
RefAuthors Hagen, J. M., Ludwig, M.
RefTitle R561C missense mutation in the SMARCAL1 gene associated
RefTitle with mild schimke immuno-osseous dysplasia.
RefLoc Pediatr Nephrol 20:1724-1728 (2005)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 24752
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 1821
Feature /codon: cgc -> tgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 561
Feature /change: R -> C
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 24752
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 9
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 1821
Feature /codon: cgc -> tgc; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 561
Feature /change: R -> C
Symptoms Progressive growth failure and nephrotic syndrome, short
Symptoms stature with a short neck and trunk, thoracic kyphosis,
Symptoms lumbar lordosis, protruding abdomen and a broad nasal
Symptoms bridge, minimal pretibial edema.
Sex XY
Ethnic origin Caucasoid; Turkey
Parents Consanguineous
Relative SMARCAL1base; S0025 brother
Comment Mild form of the disease
//
ID R561C(1b),R561C(1b); standard; MUTATION;
Accession S0025
Systematic name Allele 1 and 2: g.24752C>T, c.1681C>T, r.1681c>u,
Systematic name p.Arg561Cys
Original code II.4
Description Allele 1 and 2: a point mutation in the exon 9 leading to
Description an amino acid change
Date 10-Jan-2006 (Rel. 1, Created)
Date 10-Jan-2006 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16237566
RefAuthors Bokenkamp, A., deJong, M., van Wijk, J. A., Block, D., van
RefAuthors Hagen, J. M., Ludwig, M.
RefTitle R561C missense mutation in the SMARCAL1 gene associated
RefTitle with mild schimke immuno-osseous dysplasia.
RefLoc Pediatr Nephrol 20:1724-1728 (2005)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 24752
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 1821
Feature /codon: cgc -> tgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 561
Feature /change: R -> C
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 24752
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 9
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 1821
Feature /codon: cgc -> tgc; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 561
Feature /change: R -> C
Symptoms No clinical symptoms, but at the age of 18 months, CD4
Symptoms positive cells has significantly diminished, typical for
Symptoms the immune defect observed in SIOD.
Sex XY
Ethnic origin Caucasoid; Turkey
Parents Consanguineous
Relative SMARCAL1base; S0024 brother
//
ID S774X(1),S579L(1); standard; MUTATION;
Accession S0008
Systematic name Allele 1: g.61641C>A, c.2321C>A, r.2321c>a, p.Ser774X
Systematic name Allele 2: g.33339C>T, c.1736C>T, r.1736c>u, p.Ser579Leu
Original code Pedigree 35
Description Allele 1: a point mutation in the exon 14 leading to a
Description premature stop codon
Description Allele 2: a point mutation in the exon 10 leading to an
Description amino acid change
Date 03-Sep-2004 (Rel. 1, Created)
Date 03-Sep-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11799392
RefAuthors Boerkoel, C. F., Takashima, H., John, J., Yan, J.,
RefAuthors Stankiewicz, P., Rosenbarker, L., Andre, J. L.,
RefAuthors Bogdanovic, R., Burguet, A., Cockfield, S., Cordeiro, I.,
RefAuthors Frund, S., Illies, F., Joseph, M., Kaitila, I., Lama, G.,
RefAuthors Loirat, C., McLeod, D. R., Milford, D. V., Petty, E. M.,
RefAuthors Rodrigo, F., Saraiva, J. M., Schmidt, B., Smith, G. C.,
RefAuthors Spranger, J., Stein, A., Thiele, H., Tizard, J.,
RefAuthors Weksberg, R., Lupski, J. R., Stockton, D. W.
RefTitle Mutant chromatin remodeling protein SMARCAL1 causes
RefTitle schimke immuno-osseous dysplasia.
RefLoc Nat Genet 30:215-220 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 61641
Feature /change: c -> a
Feature /genomic_region: exon; 14
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079: 2461
Feature /codon: tcg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 774
Feature /change: S -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 33339
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 10
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 1876
Feature /codon: tcg -> ttg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 579
Feature /change: S -> L
Symptoms sphondyloepiphyseal dysplasia, dysmorphic facial features
Symptoms and hyperpigmented macules that occur predominantly on the
Symptoms trunk, renal disease, lymphocytopenia, pancytopenia,
Symptoms recurrent infections
Sex XY
Ethnic origin Caucasoid; Portugal
//
ID S579L(2),?; standard; MUTATION;
Accession S0030
Systematic name Allele 1: g.33339C>T, c.1736C>T, r.1736c>u, p.Ser579Leu
Original code Patient SD74
Description Allele 1: A point mutation in the exon 10 leading to an
Description amino acid change
Date 02-Jun-2008 (Rel. 1, Created)
Date 02-Jun-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17089404
RefAuthors Clewing, J. M., Fryssira, H., Goodman, D., Smithson, S.
RefAuthors F., Sloan, E. A., Lou, S., Huang, Y., Choi, K., Lucke, T.,
RefAuthors Alpay, H., Andre, J. L., Asakura, Y., Biebuyck-Gouge, N.,
RefAuthors Bogdanovic, R., Bonneau, D., Cancrini, C., Cochat, P.,
RefAuthors Cockfield, S., Collard, L., Cordeiro, I., Cormier-Daire,
RefAuthors V., Cransberg, K., Cutka, K., Deschenes, G., Ehrich, J.
RefAuthors H., Frund, S., Georgaki, H., Guillen-Navarro, E.,
RefAuthors Hinkelmann, B., Kanariou, M., Kasap, B., Kilic, S. S.,
RefAuthors Lama, G., Lamfers, P., Loirat, C., Majore, S., Milford,
RefAuthors D., Morin, D., Ozdemir, N., Pontz, B. F., Proesmans, W.,
RefAuthors Psoni, S., Reichenbach, H., Reif, S., Rusu, C., Saraiva,
RefAuthors J. M., Sakallioglu, O., Schmidt, B., Shoemaker, L.,
RefAuthors Sigaudy, S., Smith, G., Sotsiou, F., Stajic, N., Stein,
RefAuthors A., Stray-Pedersen, A., Taha, D., Taque, S., Tizard, J.,
RefAuthors Tsimaratos, M., Wong, N. A., Boerkoel, C. F.
RefTitle Schimke immunoosseous dysplasia: suggestions of genetic
RefTitle diversity.
RefLoc Hum Mutat:273-283 (2007)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 33339
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 1876
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 579
Feature /change: S -> L
Symptoms poor growth, microscopic hematuria, proteinuria, recurrent
Symptoms otitis media, upper respiratory infections, triangular
Symptoms face, deep set eyes, broad nasal bridge, bulbous nasal tip,
Symptoms high arched palate, long thin upper lip, short neck, barrel
Symptoms chest, lumbar lordosis, protruding abdomen, disproportion
Symptoms of trunk and limbs, hyperpigmented macules, hypermetropia,
Symptoms astigmatism, high pitched voice
Sex XY
Ethnic origin Caucasoid; Greece
Parents Non-consanguineous
//
ID R586W(1a),R586W(1a); standard; MUTATION;
Accession S0001
Systematic name Allele 1 and 2: g.33359C>T, c.1756C>T, r.1756c>u,
Systematic name p.Arg586Trp
Original code Pedigree 18; SD180
Description Allele 1 and 2: a point mutation in the exon 10 leading to
Description an amino acid change
Date 27-Feb-2004 (Rel. 7, Created)
Date 27-Feb-2004 (Rel. 7, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11799392
RefAuthors Boerkoel, C. F., Takashima, H., John, J., Yan, J.,
RefAuthors Stankiewicz, P., Rosenbarker, L., Andre, J. L.,
RefAuthors Bogdanovic, R., Burguet, A., Cockfield, S., Cordeiro, I.,
RefAuthors Frund, S., Illies, F., Joseph, M., Kaitila, I., Lama, G.,
RefAuthors Loirat, C., McLeod, D. R., Milford, D. V., Petty, E. M.,
RefAuthors Rodrigo, F., Saraiva, J. M., Schmidt, B., Smith, G. C.,
RefAuthors Spranger, J., Stein, A., Thiele, H., Tizard, J.,
RefAuthors Weksberg, R., Lupski, J. R., Stockton, D. W.
RefTitle Mutant chromatin remodeling protein SMARCAL1 causes
RefTitle schimke immuno-osseous dysplasia.
RefLoc Nat Genet 30:215-220 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 33359
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 1896
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 586
Feature /change: R -> W
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 33359
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 10
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 1896
Feature /codon: cgg -> tgg; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 586
Feature /change: R -> W
Symptoms Sphondyloepiphyseal dysplasia, renal disease,
Symptoms lymphocytopenia
Sex XY
Ethnic origin Caucasoid; Italy
Parents Consanguineous
Relative SMARCAL1base; S0002 sister
Comment Milder disease phenotype
//
ID R586W(1b),R586W(1b); standard; MUTATION;
Accession S0002
Systematic name Allele 1 and 2: g.33359C>T, c.1756C>T, r.1756c>u,
Systematic name p.Arg586Trp
Original code Pedigree 18; SD181
Description Allele 1 and 2: a point mutation in the exon 10 leading to
Description an amino acid change
Date 27-Feb-2004 (Rel. 7, Created)
Date 27-Feb-2004 (Rel. 7, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11799392
RefAuthors Boerkoel, C. F., Takashima, H., John, J., Yan, J.,
RefAuthors Stankiewicz, P., Rosenbarker, L., Andre, J. L.,
RefAuthors Bogdanovic, R., Burguet, A., Cockfield, S., Cordeiro, I.,
RefAuthors Frund, S., Illies, F., Joseph, M., Kaitila, I., Lama, G.,
RefAuthors Loirat, C., McLeod, D. R., Milford, D. V., Petty, E. M.,
RefAuthors Rodrigo, F., Saraiva, J. M., Schmidt, B., Smith, G. C.,
RefAuthors Spranger, J., Stein, A., Thiele, H., Tizard, J.,
RefAuthors Weksberg, R., Lupski, J. R., Stockton, D. W.
RefTitle Mutant chromatin remodeling protein SMARCAL1 causes
RefTitle schimke immuno-osseous dysplasia.
RefLoc Nat Genet 30:215-220 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 33359
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 1896
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 586
Feature /change: R -> W
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 33359
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 10
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 1896
Feature /codon: cgg -> tgg; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 586
Feature /change: R -> W
Symptoms Sphondyloepiphyseal dysplasia, renal disease,
Symptoms lymphocytopenia
Sex XX
Ethnic origin Caucasoid; Italy
Parents Consanguineous
Relative SMARCAL1base; S0001 brother
Comment milder disease phenotype
//
ID R820H(2),S625X(1); standard; MUTATION;
Accession S0011
Systematic name Allele 1: g.63436G>A, c.2459G>A, r.2459g>a, p.Arg820His
Systematic name Allele 2: g.37164C>G, c.1874C>G, r.1874c>g, p.Ser625X
Original code Pedigree 45
Description Allele 1: a point mutation in the exon 15 leading to an
Description amino acid change
Description Allele 2: a point mutation in the exon 11 leading to a
Description premature stop codon
Date 03-Sep-2004 (Rel. 1, Created)
Date 03-Sep-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11799392
RefAuthors Boerkoel, C. F., Takashima, H., John, J., Yan, J.,
RefAuthors Stankiewicz, P., Rosenbarker, L., Andre, J. L.,
RefAuthors Bogdanovic, R., Burguet, A., Cockfield, S., Cordeiro, I.,
RefAuthors Frund, S., Illies, F., Joseph, M., Kaitila, I., Lama, G.,
RefAuthors Loirat, C., McLeod, D. R., Milford, D. V., Petty, E. M.,
RefAuthors Rodrigo, F., Saraiva, J. M., Schmidt, B., Smith, G. C.,
RefAuthors Spranger, J., Stein, A., Thiele, H., Tizard, J.,
RefAuthors Weksberg, R., Lupski, J. R., Stockton, D. W.
RefTitle Mutant chromatin remodeling protein SMARCAL1 causes
RefTitle schimke immuno-osseous dysplasia.
RefLoc Nat Genet 30:215-220 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 63436
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 15
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 2599
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 820
Feature /change: R -> H
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 37164
Feature /change: c -> g
Feature /genomic_region: exon; 11
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079: 2014
Feature /codon: tca -> tga; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 625
Feature /change: S -> X
Sex XY
Ethnic origin Caucasoid; Norway
//
ID R645H(1a),E848X(7a); standard; MUTATION;
Accession S0040
Systematic name Allele 1: g.37224G>A, c.1934G>A, r.1934g>a, p.Arg645His
Systematic name Allele 2: g.64512G>T, c.2542G>T, r.2542g>u, p.Glu848X
Original code P.3 ref.[1]; P.1 ref.[2]
Description Allele 1: A point mutation in the exon 11 leading to an
Description amino acid change
Description Allele 2: A point mutation in the exon 16 leading to a
Description premature stop codon
Date 26-Jul-2010 (Rel. 1, Created)
Date 26-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18785907
RefAuthors Lucke, T., Kanzelmeyer, N., Baradaran-Heravi, A.,
RefAuthors Boerkoel, C. F., Burg, M., Ehrich, J. H., Pape, L.
RefTitle Improved outcome with immunosuppressive monotherapy after
RefTitle renal transplantation in schimke-immuno-osseous dysplasia.
RefLoc Pediatr Transplant:482-489 (2009)
RefNumber [2]
RefCrossRef PUBMED; 19127206
RefAuthors Zivicnjak, M., Franke, D., Zenker, M., Hoyer, J., Lucke,
RefAuthors T., Pape, L., Ehrich, J. H.
RefTitle SMARCAL1 mutations: a cause of prepubertal idiopathic
RefTitle steroid-resistant nephrotic syndrome.
RefLoc Pediatr Res:564-568 (2009)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 37224
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 16
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 2074
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 645
Feature /change: R -> H
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 64512
Feature /change: g -> t
Feature /genomic_region: exon; 16
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 2682
Feature /codon: gag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 848
Feature /change: E -> X
Symptoms Steroid resistant nephrotic syndrome; Glomerulopathy;
Age 6
Sex XX
Relative SMARCAL1base; S0041 sister
Comment Patient received maternal kidney transplant at the age of
Comment 11 years.
//
ID R645H(1b),E848X(7b); standard; MUTATION;
Accession S0041
Systematic name Allele 1: g.37224G>A, c.1934G>A, r.1934g>a, p.Arg645His
Systematic name Allele 2: g.64512G>T, c.2542G>T, r.2542g>u, p.Glu848X
Original code P.4 ref.[1]; P.2 ref.[2]
Description Allele 1: A point mutation in the exon 11 leading to an
Description amino acid change
Description Allele 2: A point mutation in the exon 16 leading to a
Description premature stop codon
Date 26-Jul-2010 (Rel. 1, Created)
Date 26-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18785907
RefAuthors Lucke, T., Kanzelmeyer, N., Baradaran-Heravi, A.,
RefAuthors Boerkoel, C. F., Burg, M., Ehrich, J. H., Pape, L.
RefTitle Improved outcome with immunosuppressive monotherapy after
RefTitle renal transplantation in schimke-immuno-osseous dysplasia.
RefLoc Pediatr Transplant:482-489 (2009)
RefNumber [2]
RefCrossRef PUBMED; 19127206
RefAuthors Zivicnjak, M., Franke, D., Zenker, M., Hoyer, J., Lucke,
RefAuthors T., Pape, L., Ehrich, J. H.
RefTitle SMARCAL1 mutations: a cause of prepubertal idiopathic
RefTitle steroid-resistant nephrotic syndrome.
RefLoc Pediatr Res:564-568 (2009)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 37224
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 16
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 2074
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 645
Feature /change: R -> H
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 64512
Feature /change: g -> t
Feature /genomic_region: exon; 16
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 2682
Feature /codon: gag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 848
Feature /change: E -> X
Symptoms Steroid resistant nephrotic syndrome; Sepsis; Abdominal
Symptoms pain; Hip dysplasia;
Age 4
Sex XX
Relative SMARCAL1base; S0040 sister
Comment Patient received DD kidney transplant.
//
ID K647Q(1),K647Q(1); standard; MUTATION;
Accession S0013
Systematic name Allele 1 and 2: g.37229A>C, c.1939A>C, r.1939a>c,
Systematic name p.Lys647Gln
Original code Pedigree 48
Description Allele 1 and 2: a point mutation in the exon 11 leading to
Description an amino acid change
Date 03-Sep-2004 (Rel. 1, Created)
Date 03-Sep-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11799392
RefAuthors Boerkoel, C. F., Takashima, H., John, J., Yan, J.,
RefAuthors Stankiewicz, P., Rosenbarker, L., Andre, J. L.,
RefAuthors Bogdanovic, R., Burguet, A., Cockfield, S., Cordeiro, I.,
RefAuthors Frund, S., Illies, F., Joseph, M., Kaitila, I., Lama, G.,
RefAuthors Loirat, C., McLeod, D. R., Milford, D. V., Petty, E. M.,
RefAuthors Rodrigo, F., Saraiva, J. M., Schmidt, B., Smith, G. C.,
RefAuthors Spranger, J., Stein, A., Thiele, H., Tizard, J.,
RefAuthors Weksberg, R., Lupski, J. R., Stockton, D. W.
RefTitle Mutant chromatin remodeling protein SMARCAL1 causes
RefTitle schimke immuno-osseous dysplasia.
RefLoc Nat Genet 30:215-220 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 37229
Feature /change: a -> c
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 2079
Feature /codon: aag -> cag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 647
Feature /change: K -> Q
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 37229
Feature /change: a -> c
Feature /genomic_region: exon; 11
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 2079
Feature /codon: aag -> cag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 647
Feature /change: K -> Q
Symptoms sphondyloepiphyseal dysplasia, dysmorphic facial features
Symptoms and hyperpigmented macules that occur predominantly on the
Symptoms trunk, renal disease, lymphocytopenia, central nervous
Symptoms system symptoms
Sex XX
Ethnic origin Caucasoid; Turkey
//
ID K647T(1),K647T(1); standard; MUTATION;
Accession S0018
Systematic name Allele 1 and 2: g.37230A>C, c.1940A>C, r.1940a>c,
Systematic name p.Lys647Thr
Original code Pedigree 27
Description Allele 1 and 2: a point mutation in the exon 11 leading to
Description an amino acid change
Date 06-Sep-2004 (Rel. 1, Created)
Date 06-Sep-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11799392
RefAuthors Boerkoel, C. F., Takashima, H., John, J., Yan, J.,
RefAuthors Stankiewicz, P., Rosenbarker, L., Andre, J. L.,
RefAuthors Bogdanovic, R., Burguet, A., Cockfield, S., Cordeiro, I.,
RefAuthors Frund, S., Illies, F., Joseph, M., Kaitila, I., Lama, G.,
RefAuthors Loirat, C., McLeod, D. R., Milford, D. V., Petty, E. M.,
RefAuthors Rodrigo, F., Saraiva, J. M., Schmidt, B., Smith, G. C.,
RefAuthors Spranger, J., Stein, A., Thiele, H., Tizard, J.,
RefAuthors Weksberg, R., Lupski, J. R., Stockton, D. W.
RefTitle Mutant chromatin remodeling protein SMARCAL1 causes
RefTitle schimke immuno-osseous dysplasia.
RefLoc Nat Genet 30:215-220 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 37230
Feature /change: a -> c
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 2080
Feature /codon: aag -> acg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 647
Feature /change: K -> T
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 37230
Feature /change: a -> c
Feature /genomic_region: exon; 11
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 2080
Feature /codon: aag -> acg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 647
Feature /change: K -> T
Symptoms sphondyloepiphyseal dysplasia, dysmorphic facial features
Symptoms and hyperpigmented macules that occur predominantly on the
Symptoms trunk, renal disease, lymphocytopenia
Sex XY
Ethnic origin Caucasoid; Algerian
Comment Milder disease phenotype
//
ID I755S(1),?; standard; MUTATION;
Accession S0037
Systematic name Allele 1: g.61584T>G, c.2264T>G, r.2264u>g, p.Ile755Ser
Description Allele 1: A point mutation in the exon 14 leading to an
Description amino acid change
Date 03-Jun-2008 (Rel. 1, Created)
Date 03-Jun-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17089404
RefAuthors Clewing, J. M., Fryssira, H., Goodman, D., Smithson, S.
RefAuthors F., Sloan, E. A., Lou, S., Huang, Y., Choi, K., Lucke, T.,
RefAuthors Alpay, H., Andre, J. L., Asakura, Y., Biebuyck-Gouge, N.,
RefAuthors Bogdanovic, R., Bonneau, D., Cancrini, C., Cochat, P.,
RefAuthors Cockfield, S., Collard, L., Cordeiro, I., Cormier-Daire,
RefAuthors V., Cransberg, K., Cutka, K., Deschenes, G., Ehrich, J.
RefAuthors H., Frund, S., Georgaki, H., Guillen-Navarro, E.,
RefAuthors Hinkelmann, B., Kanariou, M., Kasap, B., Kilic, S. S.,
RefAuthors Lama, G., Lamfers, P., Loirat, C., Majore, S., Milford,
RefAuthors D., Morin, D., Ozdemir, N., Pontz, B. F., Proesmans, W.,
RefAuthors Psoni, S., Reichenbach, H., Reif, S., Rusu, C., Saraiva,
RefAuthors J. M., Sakallioglu, O., Schmidt, B., Shoemaker, L.,
RefAuthors Sigaudy, S., Smith, G., Sotsiou, F., Stajic, N., Stein,
RefAuthors A., Stray-Pedersen, A., Taha, D., Taque, S., Tizard, J.,
RefAuthors Tsimaratos, M., Wong, N. A., Boerkoel, C. F.
RefTitle Schimke immunoosseous dysplasia: suggestions of genetic
RefTitle diversity.
RefLoc Hum Mutat:273-283 (2007)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 61584
Feature /change: t -> g
Feature /genomic_region: exon; 14
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 2404
Feature /codon: atc -> agc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 755
Feature /change: I -> S
Ethnic origin Caucasoid; Italy
//
ID #I755X756(1),?; standard; MUTATION;
Accession S0033
Systematic name Allele 1: g.61583_61602delATCGATGGCTCCACCTCATC,
Systematic name c.2263_2282delATCGATGGCTCCACCTCATC,
Systematic name r.2263_2282delaucgauggcuccaccucauc, p.Ile755fsX2
Description Allele 1: A frame shift deletion mutation in the exon 14
Description leading to a premature stop codon
Date 03-Jun-2008 (Rel. 1, Created)
Date 03-Jun-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17089404
RefAuthors Clewing, J. M., Fryssira, H., Goodman, D., Smithson, S.
RefAuthors F., Sloan, E. A., Lou, S., Huang, Y., Choi, K., Lucke, T.,
RefAuthors Alpay, H., Andre, J. L., Asakura, Y., Biebuyck-Gouge, N.,
RefAuthors Bogdanovic, R., Bonneau, D., Cancrini, C., Cochat, P.,
RefAuthors Cockfield, S., Collard, L., Cordeiro, I., Cormier-Daire,
RefAuthors V., Cransberg, K., Cutka, K., Deschenes, G., Ehrich, J.
RefAuthors H., Frund, S., Georgaki, H., Guillen-Navarro, E.,
RefAuthors Hinkelmann, B., Kanariou, M., Kasap, B., Kilic, S. S.,
RefAuthors Lama, G., Lamfers, P., Loirat, C., Majore, S., Milford,
RefAuthors D., Morin, D., Ozdemir, N., Pontz, B. F., Proesmans, W.,
RefAuthors Psoni, S., Reichenbach, H., Reif, S., Rusu, C., Saraiva,
RefAuthors J. M., Sakallioglu, O., Schmidt, B., Shoemaker, L.,
RefAuthors Sigaudy, S., Smith, G., Sotsiou, F., Stajic, N., Stein,
RefAuthors A., Stray-Pedersen, A., Taha, D., Taque, S., Tizard, J.,
RefAuthors Tsimaratos, M., Wong, N. A., Boerkoel, C. F.
RefTitle Schimke immunoosseous dysplasia: suggestions of genetic
RefTitle diversity.
RefLoc Hum Mutat:273-283 (2007)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0079: 61583..61602
Feature /change: -atcgatggct ccacctcatc
Feature /genomic_region: exon; 14
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 2403..2422
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 755..761
Feature /change: IDGSTSS -> SX
Ethnic origin Caucasoid; France
//
ID E848X(4),R764Q(1); standard; MUTATION;
Accession S0016
Systematic name Allele 1: g.64512G>T, c.2542G>T, r.2542g>u, p.Glu848X
Systematic name Allele 2: g.61611G>A, c.2291G>A, r.2291g>a, p.Arg764Gln
Original code Pedigree 53
Description Allele 1: a point mutation in the exon 16 leading to a
Description premature stop codon
Description Allele 2: a point mutation in the exon 14 leading to an
Description amino acid change
Date 06-Sep-2004 (Rel. 1, Created)
Date 06-Sep-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11799392
RefAuthors Boerkoel, C. F., Takashima, H., John, J., Yan, J.,
RefAuthors Stankiewicz, P., Rosenbarker, L., Andre, J. L.,
RefAuthors Bogdanovic, R., Burguet, A., Cockfield, S., Cordeiro, I.,
RefAuthors Frund, S., Illies, F., Joseph, M., Kaitila, I., Lama, G.,
RefAuthors Loirat, C., McLeod, D. R., Milford, D. V., Petty, E. M.,
RefAuthors Rodrigo, F., Saraiva, J. M., Schmidt, B., Smith, G. C.,
RefAuthors Spranger, J., Stein, A., Thiele, H., Tizard, J.,
RefAuthors Weksberg, R., Lupski, J. R., Stockton, D. W.
RefTitle Mutant chromatin remodeling protein SMARCAL1 causes
RefTitle schimke immuno-osseous dysplasia.
RefLoc Nat Genet 30:215-220 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 64512
Feature /change: g -> t
Feature /genomic_region: exon; 16
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079: 2682
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 848
Feature /change: E -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 61611
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 14
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 2431
Feature /codon: cgg -> cag; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 764
Feature /change: R -> Q
Symptoms sphondyloepiphyseal dysplasia, dysmorphic facial features
Symptoms and hyperpigmented macules that occur predominantly on the
Symptoms trunk, renal disease, lymphocytopenia, pancytopenia,
Symptoms recurrent infections
Sex XY
Ethnic origin Caucasoid; Germany
//
ID R820H(1),R820H(1); standard; MUTATION;
Accession S0004
Systematic name Allele 1 and 2: g.63436G>A, c.2459G>A, r.2459g>a,
Systematic name p.Arg820His
Original code Pedigree 22
Description Allele 1 and 2: a point mutation in the exon 15 leading to
Description an amino acid change
Date 03-Sep-2004 (Rel. 1, Created)
Date 03-Sep-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11799392
RefAuthors Boerkoel, C. F., Takashima, H., John, J., Yan, J.,
RefAuthors Stankiewicz, P., Rosenbarker, L., Andre, J. L.,
RefAuthors Bogdanovic, R., Burguet, A., Cockfield, S., Cordeiro, I.,
RefAuthors Frund, S., Illies, F., Joseph, M., Kaitila, I., Lama, G.,
RefAuthors Loirat, C., McLeod, D. R., Milford, D. V., Petty, E. M.,
RefAuthors Rodrigo, F., Saraiva, J. M., Schmidt, B., Smith, G. C.,
RefAuthors Spranger, J., Stein, A., Thiele, H., Tizard, J.,
RefAuthors Weksberg, R., Lupski, J. R., Stockton, D. W.
RefTitle Mutant chromatin remodeling protein SMARCAL1 causes
RefTitle schimke immuno-osseous dysplasia.
RefLoc Nat Genet 30:215-220 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 63436
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 15
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 2599
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 820
Feature /change: R -> H
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 63436
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 15
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 2599
Feature /codon: cgc -> cac; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 820
Feature /change: R -> H
Symptoms sphondyloepiphyseal dysplasia, dysmorphic facial features
Symptoms and hyperpigmented macules that occur predominantly on the
Symptoms trunk, renal disease, lymphocytopenia, pancytopenia,
Symptoms central nervous system symptoms
Sex XY
Ethnic origin Caucasoid; Wales
//
ID R820H(3),?; standard; MUTATION;
Accession S0012
Systematic name Allele 1: g.63436G>A, c.2459G>A, r.2459g>a,
Systematic name p.Arg820His
Original code Pedigree 47
Description Allele 1: a point mutation in the exon 15 leading to
Description an amino acid change
Date 03-Sep-2004 (Rel. 1, Created)
Date 03-Sep-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11799392
RefAuthors Boerkoel, C. F., Takashima, H., John, J., Yan, J.,
RefAuthors Stankiewicz, P., Rosenbarker, L., Andre, J. L.,
RefAuthors Bogdanovic, R., Burguet, A., Cockfield, S., Cordeiro, I.,
RefAuthors Frund, S., Illies, F., Joseph, M., Kaitila, I., Lama, G.,
RefAuthors Loirat, C., McLeod, D. R., Milford, D. V., Petty, E. M.,
RefAuthors Rodrigo, F., Saraiva, J. M., Schmidt, B., Smith, G. C.,
RefAuthors Spranger, J., Stein, A., Thiele, H., Tizard, J.,
RefAuthors Weksberg, R., Lupski, J. R., Stockton, D. W.
RefTitle Mutant chromatin remodeling protein SMARCAL1 causes
RefTitle schimke immuno-osseous dysplasia.
RefLoc Nat Genet 30:215-220 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 63436
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 15
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 2599
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 820
Feature /change: R -> H
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: unknown
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Symptoms sphondyloepiphyseal dysplasia, dysmorphic facial features
Symptoms and hyperpigmented macules that occur predominantly on the
Symptoms trunk, renal disease, lymphocytopenia, pancytopenia,
Symptoms recurrent infections
Sex XY
Ethnic origin Caucasoid
//
ID R820H(4),E848X(3); standard; MUTATION;
Accession S0015
Systematic name Allele 1: g.63436G>A, c.2459G>A, r.2459g>a, p.Arg820His
Systematic name Allele 2: g.64512G>T, c.2542G>T, r.2542g>u, p.Glu848X
Original code Pedigree 51
Description Allele 1: a point mutation in the exon 15 leading to an
Description amino acid change
Description Allele 2: a point mutation in the exon 16 leading to a
Description premature stop codon
Date 06-Sep-2004 (Rel. 1, Created)
Date 06-Sep-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11799392
RefAuthors Boerkoel, C. F., Takashima, H., John, J., Yan, J.,
RefAuthors Stankiewicz, P., Rosenbarker, L., Andre, J. L.,
RefAuthors Bogdanovic, R., Burguet, A., Cockfield, S., Cordeiro, I.,
RefAuthors Frund, S., Illies, F., Joseph, M., Kaitila, I., Lama, G.,
RefAuthors Loirat, C., McLeod, D. R., Milford, D. V., Petty, E. M.,
RefAuthors Rodrigo, F., Saraiva, J. M., Schmidt, B., Smith, G. C.,
RefAuthors Spranger, J., Stein, A., Thiele, H., Tizard, J.,
RefAuthors Weksberg, R., Lupski, J. R., Stockton, D. W.
RefTitle Mutant chromatin remodeling protein SMARCAL1 causes
RefTitle schimke immuno-osseous dysplasia.
RefLoc Nat Genet 30:215-220 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 63436
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 15
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079: 2599
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 820
Feature /change: R -> H
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 64512
Feature /change: g -> t
Feature /genomic_region: exon; 16
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079: 2682
Feature /codon: gag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 848
Feature /change: E -> X
Symptoms sphondyloepiphyseal dysplasia, dysmorphic facial features
Symptoms and hyperpigmented macules that occur predominantly on the
Symptoms trunk, renal disease, lymphocytopenia, central nervous
Symptoms system symptoms
Sex XX
Ethnic origin Caucasoid; Serbia
//
ID R820H(5),E848X(8); standard; MUTATION;
Accession S0042
Systematic name Allele 1: g.63436G>A, c.2459G>A, r.2459g>a, p.Arg820His
Systematic name Allele 2: g.64512G>T, c.2542G>T, r.2542g>u, p.Glu848X
Original code P.5
Description Allele 1: A point mutation in the exon 15 leading to an
Description amino acid change
Description Allele 2: A point mutation in the exon 16 leading to a
Description premature stop codon
Date 26-Jul-2010 (Rel. 1, Created)
Date 26-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18785907
RefAuthors Lucke, T., Kanzelmeyer, N., Baradaran-Heravi, A.,
RefAuthors Boerkoel, C. F., Burg, M., Ehrich, J. H., Pape, L.
RefTitle Improved outcome with immunosuppressive monotherapy after
RefTitle renal transplantation in schimke-immuno-osseous dysplasia.
RefLoc Pediatr Transplant:482-489 (2009)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 63436
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 16
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 2599
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 820
Feature /change: R -> H
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 64512
Feature /change: g -> t
Feature /genomic_region: exon; 16
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 2682
Feature /codon: gag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 848
Feature /change: E -> X
Symptoms Steroid resistant nephrotic syndrome; Hypothyroidism;
Symptoms Recurrent infections;
Age 4.5
Sex XX
Parents Non-consanguineous
Comment Patient received DD kidney transplant at the age of 7
Comment years.
//
ID I821S(1),?; standard; MUTATION;
Accession S0038
Systematic name Allele 1: g.63439T>G, c.2462T>G, r.2462u>g, p.Ile821Ser
Description Allele 1: A point mutation in the exon 15 leading to an
Description amino acid change
Date 03-Jun-2008 (Rel. 1, Created)
Date 03-Jun-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17089404
RefAuthors Clewing, J. M., Fryssira, H., Goodman, D., Smithson, S.
RefAuthors F., Sloan, E. A., Lou, S., Huang, Y., Choi, K., Lucke, T.,
RefAuthors Alpay, H., Andre, J. L., Asakura, Y., Biebuyck-Gouge, N.,
RefAuthors Bogdanovic, R., Bonneau, D., Cancrini, C., Cochat, P.,
RefAuthors Cockfield, S., Collard, L., Cordeiro, I., Cormier-Daire,
RefAuthors V., Cransberg, K., Cutka, K., Deschenes, G., Ehrich, J.
RefAuthors H., Frund, S., Georgaki, H., Guillen-Navarro, E.,
RefAuthors Hinkelmann, B., Kanariou, M., Kasap, B., Kilic, S. S.,
RefAuthors Lama, G., Lamfers, P., Loirat, C., Majore, S., Milford,
RefAuthors D., Morin, D., Ozdemir, N., Pontz, B. F., Proesmans, W.,
RefAuthors Psoni, S., Reichenbach, H., Reif, S., Rusu, C., Saraiva,
RefAuthors J. M., Sakallioglu, O., Schmidt, B., Shoemaker, L.,
RefAuthors Sigaudy, S., Smith, G., Sotsiou, F., Stajic, N., Stein,
RefAuthors A., Stray-Pedersen, A., Taha, D., Taque, S., Tizard, J.,
RefAuthors Tsimaratos, M., Wong, N. A., Boerkoel, C. F.
RefTitle Schimke immunoosseous dysplasia: suggestions of genetic
RefTitle diversity.
RefLoc Hum Mutat:273-283 (2007)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 63439
Feature /change: t -> g
Feature /genomic_region: exon; 15
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 2602
Feature /codon: att -> agt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 821
Feature /change: I -> S
Ethnic origin Caucasoid; France
//
ID E848X(1),E848X(1); standard; MUTATION;
Accession S0005
Systematic name Allele 1 and 2: g.64512G>T, c.2542G>T, r.2542g>u,
Systematic name p.Glu848X
Original code Pedigree 23
Description Allele 1 and 2: a point mutation in the exon 16 leading to
Description a premature stop codon
Date 03-Sep-2004 (Rel. 1, Created)
Date 03-Sep-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11799392
RefAuthors Boerkoel, C. F., Takashima, H., John, J., Yan, J.,
RefAuthors Stankiewicz, P., Rosenbarker, L., Andre, J. L.,
RefAuthors Bogdanovic, R., Burguet, A., Cockfield, S., Cordeiro, I.,
RefAuthors Frund, S., Illies, F., Joseph, M., Kaitila, I., Lama, G.,
RefAuthors Loirat, C., McLeod, D. R., Milford, D. V., Petty, E. M.,
RefAuthors Rodrigo, F., Saraiva, J. M., Schmidt, B., Smith, G. C.,
RefAuthors Spranger, J., Stein, A., Thiele, H., Tizard, J.,
RefAuthors Weksberg, R., Lupski, J. R., Stockton, D. W.
RefTitle Mutant chromatin remodeling protein SMARCAL1 causes
RefTitle schimke immuno-osseous dysplasia.
RefLoc Nat Genet 30:215-220 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 64512
Feature /change: g -> t
Feature /genomic_region: exon; 16
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079: 2682
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 848
Feature /change: E -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 64512
Feature /change: g -> t
Feature /genomic_region: exon; 16
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079: 2682
Feature /codon: gag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 848
Feature /change: E -> X
Symptoms sphondyloepiphyseal dysplasia, dysmorphic facial features
Symptoms and hyperpigmented macules that occur predominantly on the
Symptoms trunk, renal disease, lymphocytopenia, central nervous
Symptoms system symptoms
Sex XY
Ethnic origin Caucasoid; Finland
//
ID E848X(2),E848X(2); standard; MUTATION;
Accession S0014
Systematic name Allele 1 and 2: g.64512G>T, c.2542G>T, r.2542g>u,
Systematic name p.Glu848X
Original code Pedigree 50
Description Allele 1 and 2: a point mutation in the exon 16 leading to
Description a premature stop codon
Date 03-Sep-2004 (Rel. 1, Created)
Date 03-Sep-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11799392
RefAuthors Boerkoel, C. F., Takashima, H., John, J., Yan, J.,
RefAuthors Stankiewicz, P., Rosenbarker, L., Andre, J. L.,
RefAuthors Bogdanovic, R., Burguet, A., Cockfield, S., Cordeiro, I.,
RefAuthors Frund, S., Illies, F., Joseph, M., Kaitila, I., Lama, G.,
RefAuthors Loirat, C., McLeod, D. R., Milford, D. V., Petty, E. M.,
RefAuthors Rodrigo, F., Saraiva, J. M., Schmidt, B., Smith, G. C.,
RefAuthors Spranger, J., Stein, A., Thiele, H., Tizard, J.,
RefAuthors Weksberg, R., Lupski, J. R., Stockton, D. W.
RefTitle Mutant chromatin remodeling protein SMARCAL1 causes
RefTitle schimke immuno-osseous dysplasia.
RefLoc Nat Genet 30:215-220 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 64512
Feature /change: g -> t
Feature /genomic_region: exon; 16
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079: 2682
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 848
Feature /change: E -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 64512
Feature /change: g -> t
Feature /genomic_region: exon; 16
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079: 2682
Feature /codon: gag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 848
Feature /change: E -> X
Symptoms sphondyloepiphyseal dysplasia, dysmorphic facial features
Symptoms and hyperpigmented macules that occur predominantly on the
Symptoms trunk, renal disease, lymphocytopenia, central nervous
Symptoms system symptoms
Sex XX
Ethnic origin Caucasoid
//
ID E848X(6),E848X(6); standard; MUTATION;
Accession S0026
Systematic name Allele 1 and 2: g.64512G>T, c.2542G>T, r.2542g>u, p.Glu848X
Original code Patient 1, SD600
Description Allele 1 and 2: A point mutation in the exon 16 leading to
Description a premature stop codon
Date 02-Jun-2008 (Rel. 1, Created)
Date 02-Jun-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16840568
RefAuthors Clewing, J. M., Antalfy, B. C., Lucke, T., Najafian, B.,
RefAuthors Marwedel, K. M., Hori, A., Powel, R. M., Do, A. F.,
RefAuthors Najera, L., SantaCruz, K., Hicks, M. J., Armstrong, D. L.,
RefAuthors Boerkoel, C. F.
RefTitle Schimke immuno-osseous dysplasia: a clinicopathological
RefTitle correlation.
RefLoc J Med Genet:122-130 (2007)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 64512
Feature /change: g -> t
Feature /genomic_region: exon; 16
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 2682
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 848
Feature /change: E -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 64512
Feature /change: g -> t
Feature /genomic_region: exon; 16
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0079; GI:18463932; SMARCAL1C: 2682
Feature /codon: gag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9NZC9; SMAL1_HUMAN: 848
Feature /change: E -> X
Symptoms Lymphopenia, neutropenia, anaemia, thrombocytopenia,
Symptoms circulating T cell deficiency, hypogammaglobulnaemia, focal
Symptoms segmental glomerusclerosis (FSGS), progressive renal
Symptoms failure: renal transplant, hypertension before and after
Symptoms transplant; transient ischaemic attacks (TIA), strokes,
Symptoms pulmonary hypertension, broad low nasal bridge, bulbous
Symptoms nasal tip, microdontia, hyperpigmented macules, lumbar
Symptoms lordosis, protuberant abdomen, poor growth,
Symptoms disproportionate short stature, sponduloepiphysial
Symptoms dysplasia, degenerative hip disease
Sex XY
Ethnic origin Caucasoid
Parents Non-consanguineous
Comment deceased
//
ID Intron 4(1),Intron 6(1); standard; MUTATION;
Accession S0007
Systematic name Allele 1: g.IVS4-2A>G, c.1097-2A>G, r.1097-2a>g,
Systematic name Allele 2: g.IVS6+1GT>, c.1334+1GT>, r.1334+1gu>,
Original code Pedigree 33
Description Allele 1: a point mutation in the intron 4 leading to
Description aberrant splicing
Description Allele 2: a deletion mutation in the intron 6 leading to
Description aberrant splicing
Date 03-Sep-2004 (Rel. 1, Created)
Date 03-Sep-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11799392
RefAuthors Boerkoel, C. F., Takashima, H., John, J., Yan, J.,
RefAuthors Stankiewicz, P., Rosenbarker, L., Andre, J. L.,
RefAuthors Bogdanovic, R., Burguet, A., Cockfield, S., Cordeiro, I.,
RefAuthors Frund, S., Illies, F., Joseph, M., Kaitila, I., Lama, G.,
RefAuthors Loirat, C., McLeod, D. R., Milford, D. V., Petty, E. M.,
RefAuthors Rodrigo, F., Saraiva, J. M., Schmidt, B., Smith, G. C.,
RefAuthors Spranger, J., Stein, A., Thiele, H., Tizard, J.,
RefAuthors Weksberg, R., Lupski, J. R., Stockton, D. W.
RefTitle Mutant chromatin remodeling protein SMARCAL1 causes
RefTitle schimke immuno-osseous dysplasia.
RefLoc Nat Genet 30:215-220 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 9927
Feature /change: a -> g
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0079: 15079..15080
Feature /change: -gt
Feature /genomic_region: intron; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Symptoms sphondyloepiphyseal dysplasia, dysmorphic facial features
Symptoms and hyperpigmented macules that occur predominantly on the
Symptoms trunk, renal disease, lymphocytopenia
Sex XX
Ethnic origin Caucasoid
//
ID Intron 4(2),Intron 4(2); standard; MUTATION;
Accession S0009
Systematic name Allele 1 and 2: g.IVS4+1G>A, c.1096+1G>A, r.1096+1g>a,
Original code Pedigree 38
Description Allele 1 and 2: a point mutation in the intron 4 leading
Description to aberrant splicing
Date 03-Sep-2004 (Rel. 1, Created)
Date 03-Sep-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11799392
RefAuthors Boerkoel, C. F., Takashima, H., John, J., Yan, J.,
RefAuthors Stankiewicz, P., Rosenbarker, L., Andre, J. L.,
RefAuthors Bogdanovic, R., Burguet, A., Cockfield, S., Cordeiro, I.,
RefAuthors Frund, S., Illies, F., Joseph, M., Kaitila, I., Lama, G.,
RefAuthors Loirat, C., McLeod, D. R., Milford, D. V., Petty, E. M.,
RefAuthors Rodrigo, F., Saraiva, J. M., Schmidt, B., Smith, G. C.,
RefAuthors Spranger, J., Stein, A., Thiele, H., Tizard, J.,
RefAuthors Weksberg, R., Lupski, J. R., Stockton, D. W.
RefTitle Mutant chromatin remodeling protein SMARCAL1 causes
RefTitle schimke immuno-osseous dysplasia.
RefLoc Nat Genet 30:215-220 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 6833
Feature /change: g -> a
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 6833
Feature /change: g -> a
Feature /genomic_region: intron; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Symptoms sphondyloepiphyseal dysplasia, dysmorphic facial features
Symptoms and hyperpigmented macules that occur predominantly on the
Symptoms trunk, renal disease, lymphocytopenia, recurrent infections
Sex XY
Ethnic origin Caucasoid; Germany
//
ID Intron 4(3),Intron 4(3); standard; MUTATION;
Accession S0028
Systematic name Allele 1 and 2: g.IVS4-2A>G, c.1097-2A>G, r.
Original code Index Patient
Description Allele 1 and 2: A point mutation in the intron 4 leading to
Description an amino acid change
Date 02-Jun-2008 (Rel. 1, Created)
Date 02-Jun-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18356746
RefAuthors Dekel, B., Metsuyanim, S., Goldstein, N., Pode-Shakked,
RefAuthors N., Kovalski, Y., Cohen, Y., Davidovits, M., Anikster, Y.
RefTitle Schimke immuno-osseous dysplasia: expression of SMARCAL1
RefTitle in blood and kidney provides novel insight into disease
RefTitle phenotype.
RefLoc Pediatr Res:398-403 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0079: 9927
Feature /change: a -> g
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0079: 9927
Feature /change: a -> g
Feature /genomic_region: intron; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Symptoms fused crossed ectopic kidney, growth failure, short
Symptoms stature, short neck and trunk, thoracic kyphosis, lumbar
Symptoms lordosis, protruding abdomen, edema, atopic dermatitis,
Symptoms hyperpigmented spots, hypoalbuminemia, elevated cholesterol
Symptoms levels, nephrotic syndrome with proteinuria, dyslipidemia
Sex XY
Ethnic origin Ashkenazi
Parents Non-consanguineous
//
ID Intron 5(1),Intron 5(1); standard; MUTATION;
Accession S0020
Systematic name Allele 1 and 2: g.9978_9979delAA; g.IVS5+1GT>,
Systematic name c.1146_1147delAA; c.1147+1GT>,
Systematic name r.1146_1147delaa; r.1147+1gu>,
Description Allele 1 and 2: a deletion in intron 5 and exon 5
Description leading to an aberrant splicing
Date 21-Mar-2005 (Rel. 1, Created)
Date 21-Mar-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15523612
RefAuthors Taha, D., Boerkoel, C. F., Balfe, J. W., Khalifah, M.,
RefAuthors Sloan, E. A., Barbar, M., Haider, A., Kanaan, H.
RefTitle Fatal lymphoproliferative disorder in a child with schimke
RefTitle immuno-osseous dysplasia.
RefLoc Am J Med Genet A 131A:194-199 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0079: 9978..9981
Feature /change: -aagt
Feature /genomic_region: exon; 5, intron; 5
Feature /note: originally in Ref[1]: exon; 6, intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0079: 9978..9981
Feature /change: -aagt
Feature /genomic_region: exon; 5, intron; 5
Feature /note: originally in Ref[1]: exon; 6, intron; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Symptoms Fever of 3 weeks duration, mild cough, retarded growth,
Symptoms nephrotic syndrome, hypertension, leukopenia, EBV-related
Symptoms B-cell lymphoma
Sex XY
Ethnic origin Caucasoid; Saudi-Arabia
Parents Consanguineous
Comment Patient developed multiorgan failure and died at the age of
Comment five years after 1 month of hospitalization
//
//
|
