Database SERPING1base
Version 1.2
File serping1pub.html
Date 16-Jun-2011
Curator Mauno Vihinen
Address Protein Structure and Bioinformatics
Address Lund University, BMC D10, SE-22184 Lund, Sweden
Phone +46 72 526 0022
Fax +46 46 222 9328
Email Mauno Vihinen
URL http://structure.bmc.lu.se/idbase/SERPING1base/
IDR factfile http://structure.bmc.lu.se/idbase/IDRefSeq/xml/idr/ff/FF97.html
Gene SERPING1
Disease Hereditary angioedema
OMIM 606860
GDB 119041
Sequence IDRefSeq:D0077; IDRefSeq:C0077; UniProt:P05155
Numbering start of the entry
Funding Tampere University Hospital Medical Research Fund
Funding European Union
Comments sequence entry reference in every entry
//
ID &F225(1a); standard; MUTATION;
Accession S0280
Systematic name g.5656_5657delinsAA, c.674_675delinsAA, r.674_675delinsaa,
Systematic name p.Phe225X
Original code A.1
Description A complex mutation in the exon 4 leading to a premature
Description stop codon
Date 26-Jul-2010 (Rel. 1, Created)
Date 26-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 19706314
RefAuthors Speletas, M., Boukas, K., Papadopoulou-Alataki, E.,
RefAuthors Tsitsami, E., Germenis, A. E.
RefTitle Hereditary angioedema in greek families caused by novel
RefTitle and recurrent mutations.
RefLoc Hum Immunol:925-929 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: complex
Feature /loc: IDRefSeq: D0077: 5656..5657
Feature /change: tc -> aa
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077; GI:4557378; SERPING1C: 734..735
Feature /codon: ttc -> taa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 225
Feature /change: F -> X
Diagnosis HAE
Symptoms Swelling of hands and face;
Age 51
Sex XY
Ethnic origin Greece
Relative SERPING1base; S0281 son
Relative SERPING1base; S0282
Relative SERPING1base; S0283
//
ID &F225(1b); standard; MUTATION;
Accession S0281
Systematic name g.5656_5657delinsAA, c.674_675delinsAA, r.674_675delinsaa,
Systematic name p.Phe225X
Original code A.2
Description A complex mutation in the exon 4 leading to a premature
Description stop codon
Date 26-Jul-2010 (Rel. 1, Created)
Date 26-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 19706314
RefAuthors Speletas, M., Boukas, K., Papadopoulou-Alataki, E.,
RefAuthors Tsitsami, E., Germenis, A. E.
RefTitle Hereditary angioedema in greek families caused by novel
RefTitle and recurrent mutations.
RefLoc Hum Immunol:925-929 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: complex
Feature /loc: IDRefSeq: D0077: 5656..5657
Feature /change: tc -> aa
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077; GI:4557378; SERPING1C: 734..735
Feature /codon: ttc -> taa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 225
Feature /change: F -> X
Diagnosis HAE
Symptoms Swelling of hands and face;
Age 20
Sex XY
Ethnic origin Greece
Relative SERPING1base; S0280 father
Relative SERPING1base; S0282
Relative SERPING1base; S0283
//
ID &F225(1c); standard; MUTATION;
Accession S0282
Systematic name g.5656_5657delinsAA, c.674_675delinsAA, r.674_675delinsaa,
Systematic name p.Phe225X
Original code A.3
Description A complex mutation in the exon 4 leading to a premature
Description stop codon
Date 26-Jul-2010 (Rel. 1, Created)
Date 26-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 19706314
RefAuthors Speletas, M., Boukas, K., Papadopoulou-Alataki, E.,
RefAuthors Tsitsami, E., Germenis, A. E.
RefTitle Hereditary angioedema in greek families caused by novel
RefTitle and recurrent mutations.
RefLoc Hum Immunol:925-929 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: complex
Feature /loc: IDRefSeq: D0077: 5656..5657
Feature /change: tc -> aa
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077; GI:4557378; SERPING1C: 734..735
Feature /codon: ttc -> taa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 225
Feature /change: F -> X
Diagnosis HAE
Symptoms Swelling of hands and face;
Sex XX
Ethnic origin Greece
Relative SERPING1base; S0280
Relative SERPING1base; S0281
Relative SERPING1base; S0283 daughter
//
ID &F225(1d); standard; MUTATION;
Accession S0283
Systematic name g.5656_5657delinsAA, c.674_675delinsAA, r.674_675delinsaa,
Systematic name p.Phe225X
Original code A.4
Description A complex mutation in the exon 4 leading to a premature
Description stop codon
Date 26-Jul-2010 (Rel. 1, Created)
Date 26-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 19706314
RefAuthors Speletas, M., Boukas, K., Papadopoulou-Alataki, E.,
RefAuthors Tsitsami, E., Germenis, A. E.
RefTitle Hereditary angioedema in greek families caused by novel
RefTitle and recurrent mutations.
RefLoc Hum Immunol:925-929 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: complex
Feature /loc: IDRefSeq: D0077: 5656..5657
Feature /change: tc -> aa
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077; GI:4557378; SERPING1C: 734..735
Feature /codon: ttc -> taa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 225
Feature /change: F -> X
Diagnosis HAE
Symptoms Swelling of hands and face;
Age 38
Sex XX
Ethnic origin Greece
Relative SERPING1base; S0280
Relative SERPING1base; S0281
Relative SERPING1base; S0282 mother
//
ID M1V(1a); standard; MUTATION;
Accession S0287
Systematic name g.1769A>G, c.1A>G, r.1a>g, p.Met1Val
Original code C.1
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 26-Jul-2010 (Rel. 1, Created)
Date 26-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 19706314
RefAuthors Speletas, M., Boukas, K., Papadopoulou-Alataki, E.,
RefAuthors Tsitsami, E., Germenis, A. E.
RefTitle Hereditary angioedema in greek families caused by novel
RefTitle and recurrent mutations.
RefLoc Hum Immunol:925-929 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 1769
Feature /change: a -> g
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077; GI:4557378; SERPING1C: 61
Feature /codon: atg -> gtg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 1
Feature /change: M -> V
Diagnosis HAE
Age 48
Sex XX
Ethnic origin Greece
Relative SERPING1base; S0288 daughter
Relative SERPING1base; S0289 sister
Relative SERPING1base; S0290 nephew
//
ID M1V(1b); standard; MUTATION;
Accession S0288
Systematic name g.1769A>G, c.1A>G, r.1a>g, p.Met1Val
Original code C.2
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 26-Jul-2010 (Rel. 1, Created)
Date 26-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 19706314
RefAuthors Speletas, M., Boukas, K., Papadopoulou-Alataki, E.,
RefAuthors Tsitsami, E., Germenis, A. E.
RefTitle Hereditary angioedema in greek families caused by novel
RefTitle and recurrent mutations.
RefLoc Hum Immunol:925-929 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 1769
Feature /change: a -> g
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077; GI:4557378; SERPING1C: 61
Feature /codon: atg -> gtg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 1
Feature /change: M -> V
Diagnosis HAE
Age 25
Sex XX
Ethnic origin Greece
Relative SERPING1base; S0287 mother
Relative SERPING1base; S0289 aunt
Relative SERPING1base; S0290 cousin
//
ID M1V(1c); standard; MUTATION;
Accession S0289
Systematic name g.1769A>G, c.1A>G, r.1a>g, p.Met1Val
Original code C.3
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 26-Jul-2010 (Rel. 1, Created)
Date 26-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 19706314
RefAuthors Speletas, M., Boukas, K., Papadopoulou-Alataki, E.,
RefAuthors Tsitsami, E., Germenis, A. E.
RefTitle Hereditary angioedema in greek families caused by novel
RefTitle and recurrent mutations.
RefLoc Hum Immunol:925-929 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 1769
Feature /change: a -> g
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077; GI:4557378; SERPING1C: 61
Feature /codon: atg -> gtg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 1
Feature /change: M -> V
Diagnosis HAE
Age 44
Sex XX
Ethnic origin Greece
Relative SERPING1base; S0287 sister
Relative SERPING1base; S0288 neice
Relative SERPING1base; S0290 son
//
ID M1V(1d); standard; MUTATION;
Accession S0290
Systematic name g.1769A>G, c.1A>G, r.1a>g, p.Met1Val
Original code C.4
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 26-Jul-2010 (Rel. 1, Created)
Date 26-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 19706314
RefAuthors Speletas, M., Boukas, K., Papadopoulou-Alataki, E.,
RefAuthors Tsitsami, E., Germenis, A. E.
RefTitle Hereditary angioedema in greek families caused by novel
RefTitle and recurrent mutations.
RefLoc Hum Immunol:925-929 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 1769
Feature /change: a -> g
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077; GI:4557378; SERPING1C: 61
Feature /codon: atg -> gtg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 1
Feature /change: M -> V
Diagnosis HAE
Age 2
Sex XY
Ethnic origin Greece
Relative SERPING1base; S0287 aunt
Relative SERPING1base; S0288 cousin
Relative SERPING1base; S0290 mother
//
ID @R4X8(1); standard; MUTATION;
Accession S0049
Systematic name g.1771_1778dup, c.3_10dup, r.3_10dup, p.Leu5fsX4
Original code A:27
Description A frame shift duplication mutation in the exon 2 leading
Description to a premature stop codon
Date 30-Jul-2004 (Rel. 1, Created)
Date 30-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0077: 1779
Feature /change: +ggcctcca
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 71
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 4
Feature /change: R -> RPPGX
Diagnosis HAE Type I
//
ID @T6X9(1); standard; MUTATION;
Accession S0051
Systematic name g.1783_1784dup, c.15_16dup, r.15_16dup, p.Thr6fsX4
Original code Kindred 1
Description A frame shift duplication mutation in the exon 2 leading
Description to a premature stop codon
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0077: 1785
Feature /change: +ga
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 77
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 6
Feature /change: T -> RPCX
Diagnosis HAE Type I
//
ID S22X(1); standard; MUTATION;
Accession S0200
Systematic name g.3391C>G, c.65C>G, r.65c>g, p.Ser22X
Original code BU
Description A point mutation in the exon 3 leading to a premature stop
Description codon
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3391
Feature /change: c -> g
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 125
Feature /codon: tca -> tga; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 22
Feature /change: S -> X
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID #N23X33(1a); standard; MUTATION;
Accession S0278
Systematic name g.3393_3463del, c.67_137del, r.67_137del, p.Pro24fsX10
Original code Index Patient
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 02-Jun-2008 (Rel. 1, Created)
Date 02-Jun-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17941288
RefAuthors Yu, T. C., Shyur, S. D., Huang, L. H., Wen, D. C., Li, J.
RefAuthors S.
RefTitle Paternal mosaicism and hereditary angioedema in a
RefTitle taiwanese family.
RefLoc Ann Allergy Asthma Immunol:375-379 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3393..3463
Feature /change: -aatccaaatg ctaccagctc cagctcccag gatccagaga
Feature /change: gtttgcaaga cagaggcgaa gggaaggtcg c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077; GI:4557378; SERPING1C: 127..197
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 23..46
Feature /change: NPNATSSSSQ DPESLQDRGE GKVA -> NNSYLQDAIR X
Diagnosis HAE Type I
Protein exp. very low C4 and C1 INH serum levels
Symptoms approximately 30 episodes of angioedema since the age of 20
Symptoms years
Age 20
Sex XY
Ethnic origin Mongoloid; Taiwan
Family history Inherited
Relative SERPING1base; S0279brother
//
ID #N23X33(1b); standard; MUTATION;
Accession S0279
Systematic name g.3393_3463del, c.67_137del, r.67_137del, p.Pro24fsX10
Original code Younger brother
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 02-Jun-2008 (Rel. 1, Created)
Date 02-Jun-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17941288
RefAuthors Yu, T. C., Shyur, S. D., Huang, L. H., Wen, D. C., Li, J.
RefAuthors S.
RefTitle Paternal mosaicism and hereditary angioedema in a
RefTitle taiwanese family.
RefLoc Ann Allergy Asthma Immunol:375-379 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3393..3463
Feature /change: -aatccaaatg ctaccagctc cagctcccag gatccagaga
Feature /change: gtttgcaaga cagaggcgaa gggaaggtcg c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077; GI:4557378; SERPING1C: 127..197
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 23..46
Feature /change: NPNATSSSSQ DPESLQDRGE GKVA -> NNSYLQDAIR X
Diagnosis HAE Type I
Protein exp. very low C4 and C1 INH serum levels
Symptoms 2 episodes of peripheral edema in the previous 2 years
Age 23
Sex XY
Ethnic origin Mongoloid; Taiwan
Family history Inherited
Relative SERPING1base; S0278brother
//
ID Q32X(1); standard; MUTATION;
Accession S0159
Systematic name g.3420C>T, c.94C>T, r.94c>u, p.Gln32X
Description A point mutation in the exon 3 leading to a premature stop
Description codon
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3420
Feature /change: c -> t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 154
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 32
Feature /change: Q -> X
Diagnosis HAE Type I
Ethnic origin Caucasoid; Hungary
//
ID Q32X(2); standard; MUTATION;
Accession S0201
Systematic name g.3420C>T, c.94C>T, r.94c>u, p.Gln32X
Original code DH
Description A point mutation in the exon 3 leading to a premature stop
Description codon
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3420
Feature /change: c -> t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 154
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 32
Feature /change: Q -> X
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID #S36X56(1); standard; MUTATION;
Accession S0033
Systematic name g.3432_3433delAG, c.106_107delAG, r.106_107delag,
Systematic name p.Ser36fsX21
Original code B:6
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3432..3433
Feature /change: -ag
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077:
Feature /loc: 166..167
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 36
Feature /change: S -> FARQRRREGR NNSYLQDAIR X
Diagnosis HAE Type I
//
ID #R40X56(1a); standard; MUTATION;
Accession S0095
Systematic name g.3446_3447delAG, c.120_121delAG, r.120_121delag,
Systematic name p.Gly41fsX16
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 03-Aug-2004 (Rel. 1, Created)
Date 03-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11933207
RefAuthors Freiberger, T., Kolarova, L., Mejstrik, P., Vyskocilova,
RefAuthors M., Kuklinek, P., Litzman, J.
RefTitle Five novel mutations in the C1 inhibitor gene (C1NH)
RefTitle leading to a premature stop codon in patients with type I
RefTitle hereditary angioedema.
RefLoc Hum Mutat 19:461 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3446..3447
Feature /change: -ag
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077:
Feature /loc: 180..181
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 40..41
Feature /change: RG -> RRREGRNNSY LQDAIRX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Czech
Family history Inherited
Relative SERPING1base; S0096
Relative SERPING1base; S0097
//
ID #R40X56(1b); standard; MUTATION;
Accession S0096
Systematic name g.3446_3447delAG, c.120_121delAG, r.120_121delag,
Systematic name p.Gly41fsX16
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 03-Aug-2004 (Rel. 1, Created)
Date 03-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11933207
RefAuthors Freiberger, T., Kolarova, L., Mejstrik, P., Vyskocilova,
RefAuthors M., Kuklinek, P., Litzman, J.
RefTitle Five novel mutations in the C1 inhibitor gene (C1NH)
RefTitle leading to a premature stop codon in patients with type I
RefTitle hereditary angioedema.
RefLoc Hum Mutat 19:461 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3446..3447
Feature /change: -ag
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077:
Feature /loc: 180..181
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 40..41
Feature /change: RG -> RRREGRNNSY LQDAIRX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Czech
Family history Inherited
Relative SERPING1base; S0095
Relative SERPING1base; S0097
//
ID #R40X56(1c); standard; MUTATION;
Accession S0097
Systematic name g.3446_3447delAG, c.120_121delAG, r.120_121delag,
Systematic name p.Gly41fsX16
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 03-Aug-2004 (Rel. 1, Created)
Date 03-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11933207
RefAuthors Freiberger, T., Kolarova, L., Mejstrik, P., Vyskocilova,
RefAuthors M., Kuklinek, P., Litzman, J.
RefTitle Five novel mutations in the C1 inhibitor gene (C1NH)
RefTitle leading to a premature stop codon in patients with type I
RefTitle hereditary angioedema.
RefLoc Hum Mutat 19:461 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3446..3447
Feature /change: -ag
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077:
Feature /loc: 180..181
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 40..41
Feature /change: RG -> RRREGRNNSY LQDAIRX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Czech
Family history Inherited
Relative SERPING1base; S0095
Relative SERPING1base; S0096
//
ID #R40X56(2); standard; MUTATION;
Accession S0203
Systematic name g.3446_3447delAG, c.120_121delAG, r.120_121delag,
Systematic name p.Gly41fsX16
Original code DO
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3446..3447
Feature /change: -ag
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 180..181
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 40..41
Feature /change: RG -> RRREGRNNSY LQDAIRX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
Family history De novo
//
ID #R40X78(1); standard; MUTATION;
Accession S0202
Systematic name g.3446delA, c.120delA, r.120dela, p.Gly41fsX38
Original code BQ
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3446
Feature /change: -a
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 180
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 40
Feature /change: R -> RAKGRSQQQL SPRCYSLNPS WRFPACRQPT QQPIQPPKX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID #L54X78(1); standard; MUTATION;
Accession S0098
Systematic name g.3486delC, c.160delC, r.160delc, p.Leu54fsX25
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 03-Aug-2004 (Rel. 1, Created)
Date 03-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11933207
RefAuthors Freiberger, T., Kolarova, L., Mejstrik, P., Vyskocilova,
RefAuthors M., Kuklinek, P., Litzman, J.
RefTitle Five novel mutations in the C1 inhibitor gene (C1NH)
RefTitle leading to a premature stop codon in patients with type I
RefTitle hereditary angioedema.
RefLoc Hum Mutat 19:461 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3486
Feature /change: -c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 220
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 54
Feature /change: L -> YSLNPSWRFP ACRQPTQQPI QPPKX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Czech
//
ID #F55X78(1); standard; MUTATION;
Accession S0204
Systematic name g.3490delT, c.164delT, r.164delu, p.Phe55fsX24
Original code W
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3490
Feature /change: -t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 224
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 55
Feature /change: F -> SLNPSWRFPA CRQPTQQPIQ PPKX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
Family history De novo
//
ID #S63X78(1); standard; MUTATION;
Accession S0205
Systematic name g.3513delT, c.187delT, r.187delu, p.Ser63fsX16
Original code AH
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3513
Feature /change: -t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 247
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 63
Feature /change: S -> PACRQPTQQP IQPPKX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID S70X(1); standard; MUTATION;
Accession S0099
Systematic name g.3535C>G, c.209C>G, r.209c>g, p.Ser70X
Description A point mutation in the exon 3 leading to a premature stop
Description codon
Date 03-Aug-2004 (Rel. 1, Created)
Date 03-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11933207
RefAuthors Freiberger, T., Kolarova, L., Mejstrik, P., Vyskocilova,
RefAuthors M., Kuklinek, P., Litzman, J.
RefTitle Five novel mutations in the C1 inhibitor gene (C1NH)
RefTitle leading to a premature stop codon in patients with type I
RefTitle hereditary angioedema.
RefLoc Hum Mutat 19:461 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3535
Feature /change: c -> g
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 269
Feature /codon: tca -> tga; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 70
Feature /change: S -> X
Diagnosis HAE Type I
Ethnic origin Caucasoid; Czech
//
ID #P90X147(1); standard; MUTATION;
Accession S0206
Systematic name g.3596delC, c.270delC, r.270delc, p.Thr91fsX57
Original code BN
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3596
Feature /change: -c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 330
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 90
Feature /change: P ->
Feature /change: PPQSPPPNPP SNPPNQLPSS QQILLPSPLL GPSAQDLLLS
Feature /change: ALTWRVIQQR PCWGMLWX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID #Q97X130(1); standard; MUTATION;
Accession S0207
Systematic name g.3617_3621delACCCA, c.291_295delACCCA, r.291_295delaccca,
Systematic name p.Gln97fsX34
Original code G
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3617..3621
Feature /change: -accca
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 351..355
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 97..99
Feature /change: QPT -> HHPTHPTNYP APNRFSYPAH YWVLLPRTCY SLLX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID #P105X146(1a); standard; MUTATION;
Accession S0175
Systematic name g.3640_3643delCAAC, c.314_317delCAAC, r.314_317delcaac,
Systematic name p.Pro105fsX42
Original code V-1
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 06-Aug-2004 (Rel. 1, Created)
Date 06-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14569137
RefAuthors Cumming, S. A., Halsall, D. J., Ewan, P. W., Lomas, D. A.
RefTitle The effect of sequence variations within the coding
RefTitle region of the C1 inhibitor gene on disease expression and
RefTitle protein function in families with hereditary angio-oedema.
RefLoc J Med Genet 40:e114 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3640..3643
Feature /change: -caac
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077:
Feature /loc: 374..377
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 105..106
Feature /change: PT ->
Feature /change: LPSSQQILLP SPLLGPSAQD LLLSALTWRV IQQRPCWGML WX
Diagnosis HAE Type I
Family history Inherited
Relative SERPING1base; S0176 sister
Relative SERPING1base; S0177 aunt
Relative SERPING1base; S0178 cousin
//
ID #P105X146(1b); standard; MUTATION;
Accession S0176
Systematic name g.3640_3643delCAAC, c.314_317delCAAC, r.314_317delcaac,
Systematic name p.Pro105fsX42
Original code V-2
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 06-Aug-2004 (Rel. 1, Created)
Date 06-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14569137
RefAuthors Cumming, S. A., Halsall, D. J., Ewan, P. W., Lomas, D. A.
RefTitle The effect of sequence variations within the coding
RefTitle region of the C1 inhibitor gene on disease expression and
RefTitle protein function in families with hereditary angio-oedema.
RefLoc J Med Genet 40:e114 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3640..3643
Feature /change: -caac
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077:
Feature /loc: 374..377
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 105..106
Feature /change: PT ->
Feature /change: LPSSQQILLP SPLLGPSAQD LLLSALTWRV IQQRPCWGML WX
Diagnosis HAE Type I
Family history Inherited
Relative SERPING1base; S0175 sister
Relative SERPING1base; S0177 aunt
Relative SERPING1base; S0178 cousin
//
ID #P105X146(1c); standard; MUTATION;
Accession S0177
Systematic name g.3640_3643delCAAC, c.314_317delCAAC, r.314_317delcaac,
Systematic name p.Pro105fsX42
Original code V-5
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 06-Aug-2004 (Rel. 1, Created)
Date 06-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14569137
RefAuthors Cumming, S. A., Halsall, D. J., Ewan, P. W., Lomas, D. A.
RefTitle The effect of sequence variations within the coding
RefTitle region of the C1 inhibitor gene on disease expression and
RefTitle protein function in families with hereditary angio-oedema.
RefLoc J Med Genet 40:e114 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3640..3643
Feature /change: -caac
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077:
Feature /loc: 374..377
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 105..106
Feature /change: PT ->
Feature /change: LPSSQQILLP SPLLGPSAQD LLLSALTWRV IQQRPCWGML WX
Diagnosis HAE Type I
Family history Inherited
Relative SERPING1base; S0175 niece
Relative SERPING1base; S0176 niece
Relative SERPING1base; S0178 daughter
//
ID #P105X146(1d); standard; MUTATION;
Accession S0178
Systematic name g.3640_3643delCAAC, c.314_317delCAAC, r.314_317delcaac,
Systematic name p.Pro105fsX42
Original code V-3
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 06-Aug-2004 (Rel. 1, Created)
Date 06-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14569137
RefAuthors Cumming, S. A., Halsall, D. J., Ewan, P. W., Lomas, D. A.
RefTitle The effect of sequence variations within the coding
RefTitle region of the C1 inhibitor gene on disease expression and
RefTitle protein function in families with hereditary angio-oedema.
RefLoc J Med Genet 40:e114 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3640..3643
Feature /change: -caac
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077:
Feature /loc: 374..377
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 105..106
Feature /change: PT ->
Feature /change: LPSSQQILLP SPLLGPSAQD LLLSALTWRV IQQRPCWGML WX
Diagnosis HAE Type I
Family history Inherited
Relative SERPING1base; S0175 cousin
Relative SERPING1base; S0176 cousin
Relative SERPING1base; S0177 mother
//
ID @Q108X132(1); standard; MUTATION;
Accession S0091
Systematic name g.3649dupA, c.323dupA, r.323dupa, p.Leu109fsX24
Original code P2
Description A frame shift duplication mutation in the exon 3 leading
Description to a premature stop codon
Date 03-Aug-2004 (Rel. 1, Created)
Date 03-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11161971
RefAuthors Bowen, B., Hawk, J. J., Sibunka, S., Hovick, S., Weiler,
RefAuthors J. M.
RefTitle A review of the reported defects in the human C1 esterase
RefTitle inhibitor gene producing hereditary angioedema including
RefTitle four new mutations.
RefLoc Clin Immunol 98:157-163 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0077: 3650
Feature /change: +a
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 384
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 108
Feature /change: Q -> QAPNRFSYPA HYWVLLPRTC YSLLX
Diagnosis HAE Type I
//
ID Q116X(1); standard; MUTATION;
Accession S0120
Systematic name g.3672C>T, c.346C>T, r.346c>u, p.Gln116X
Original code Patient 161
Description A point mutation in the exon 3 leading to a premature stop
Description codon
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11112899
RefAuthors Pappalardo, E., Cicardi, M., Duponchel, C., Carugati, A.,
RefAuthors Choquet, S., Agostoni, A., Tosi, M.
RefTitle Frequent de novo mutations and exon deletions in the
RefTitle C1inhibitor gene of patients with angioedema.
RefLoc J Allergy Clin Immunol 106:1147-1154 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3672
Feature /change: c -> t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 406
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 116
Feature /change: Q -> X
Diagnosis HAE
//
ID C130Y(1); standard; MUTATION;
Accession S0149
Systematic name g.3715G>A, c.389G>A, r.389g>a, p.Cys130Tyr
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3715
Feature /change: g -> a
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 449
Feature /codon: tgc -> tac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 130
Feature /change: C -> Y
Diagnosis HAE Type I
Ethnic origin Caucasoid; Hungary
//
ID C130Y(2); standard; MUTATION;
Accession S0150
Systematic name g.3715G>A, c.389G>A, r.389g>a, p.Cys130Tyr
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3715
Feature /change: g -> a
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 449
Feature /codon: tgc -> tac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 130
Feature /change: C -> Y
Diagnosis HAE Type I
Ethnic origin Caucasoid; Hungary
//
ID #C130X131(1); standard; MUTATION;
Accession S0162
Systematic name g.3716_3717delCT, c.390_391delCT, r.390_391delcu,
Systematic name p.Ser131fsX1
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3716..3717
Feature /change: -ct
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 450..451
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 130..131
Feature /change: CS -> CX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Hungary
//
ID #D144X147(1); standard; MUTATION;
Accession S0208
Systematic name g.3756delG, c.430delG, r.430delg, p.Asp144fsX4
Original code AM
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3756
Feature /change: -g
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 490
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 144
Feature /change: D -> MLWX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID #A145-14(1); standard; MUTATION;
Accession S0163
Systematic name g.3761_3802del, c.435_476del, r.435_476del, p.Ala145del
Description An inframe deletion in the exon 3 leading to an amino acid
Description change
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3761..3802
Feature /change: -tttggtagat ttctccctga agctctacca cgccttctca gc
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0077:
Feature /loc: 495..536
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P05155; IC1_HUMAN: 145..159
Feature /change: ALVDFSLKLY HAFSA -> A
Diagnosis HAE Type I
Ethnic origin Caucasoid; Hungary
//
ID #A145-14(2); standard; MUTATION;
Accession S0164
Systematic name g.3761_3802del, c.435_476del, r.435_476del, p.Ala145del
Description An inframe deletion in the exon 3 leading to an amino acid
Description change
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3761..3802
Feature /change: -tttggtagat ttctccctga agctctacca cgccttctca gc
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0077:
Feature /loc: 495..536
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P05155; IC1_HUMAN: 145..159
Feature /change: ALVDFSLKLY HAFSA -> A
Diagnosis HAE Type I
Ethnic origin Caucasoid; Hungary
//
ID Y154X(1); standard; MUTATION;
Accession S0209
Systematic name g.3788C>G, c.462C>G, r.462c>g, p.Tyr154X
Original code H
Description A point mutation in the exon 3 leading to a premature stop
Description codon
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3788
Feature /change: c -> g
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 522
Feature /codon: tac -> tag; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 154
Feature /change: Y -> X
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID F169S(1); standard; MUTATION;
Accession S0034
Systematic name g.3832T>C, c.506T>C, r.506u>c, p.Phe169Ser
Original code B:24
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3832
Feature /change: t -> c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 566
Feature /codon: ttt -> tct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 169
Feature /change: F -> S
Diagnosis HAE Type I
//
ID F169S(2); standard; MUTATION;
Accession S0210
Systematic name g.3832T>C, c.506T>C, r.506u>c, p.Phe169Ser
Original code DF
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3832
Feature /change: t -> c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 566
Feature /codon: ttt -> tct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 169
Feature /change: F -> S
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID S170P(1); standard; MUTATION;
Accession S0113
Systematic name g.3834T>C, c.508T>C, r.508u>c, p.Ser170Pro
Original code Patient 81
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11112899
RefAuthors Pappalardo, E., Cicardi, M., Duponchel, C., Carugati, A.,
RefAuthors Choquet, S., Agostoni, A., Tosi, M.
RefTitle Frequent de novo mutations and exon deletions in the
RefTitle C1inhibitor gene of patients with angioedema.
RefLoc J Allergy Clin Immunol 106:1147-1154 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3834
Feature /change: t -> c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 568
Feature /codon: tcc -> ccc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 170
Feature /change: S -> P
Diagnosis HAE
//
ID P171L(1); standard; MUTATION;
Accession S0035
Systematic name g.3838C>T, c.512C>T, r.512c>u, p.Pro171Leu
Original code B:14
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3838
Feature /change: c -> t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 572
Feature /codon: cca -> cta; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 171
Feature /change: P -> L
Diagnosis HAE Type I
//
ID P171L(2); standard; MUTATION;
Accession S0211
Systematic name g.3838C>T, c.512C>T, r.512c>u, p.Pro171Leu
Original code AG
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3838
Feature /change: c -> t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 572
Feature /codon: cca -> cta; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 171
Feature /change: P -> L
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID @T179X211(1); standard; MUTATION;
Accession S0036
Systematic name g.3859_3860dup, c.533_534dup, r.533_534dup, p.Thr179fsX33
Original code B:37
Description A frame shift duplication mutation in the exon 3 leading
Description to a premature stop codon
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0077: 3861
Feature /change: +tt
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 595
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 179
Feature /change: T -> LPRSCSGLGR TPKQTWRASS LTPRTSPVST RPX
Diagnosis HAE Type I
//
ID G184E(1a); standard; MUTATION;
Accession S0058
Systematic name g.5533G>A, c.551G>A, r.551g>a, p.Gly184Glu
Original code Kindred 5(1)
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 5533
Feature /change: g -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 611
Feature /codon: ggg -> gag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 184
Feature /change: G -> E
Diagnosis HAE Type I
Relative SERPING1base; S0059
//
ID G184E(1b); standard; MUTATION;
Accession S0059
Systematic name g.5533G>A, c.551G>A, r.551g>a, p.Gly184Glu
Original code Kindred 5(2)
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 5533
Feature /change: g -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 611
Feature /codon: ggg -> gag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 184
Feature /change: G -> E
Diagnosis HAE Type I
Relative SERPING1base; S0058
//
ID G184R(1); standard; MUTATION;
Accession S0037
Systematic name g.3876G>A, c.550G>A, r.550g>a, p.Gly184Arg
Original code B:20
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3876
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 610
Feature /codon: ggg -> agg; 1
Feature /note: mutation may also lead to aberrant splicing
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 184
Feature /change: G -> R
Diagnosis HAE Type I
//
ID G184R(2); standard; MUTATION;
Accession S0038
Systematic name g.3876G>A, c.550G>A, r.550g>a, p.Gly184Arg
Original code B:28
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3876
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 610
Feature /codon: ggg -> agg; 1
Feature /note: mutation may also lead to aberrant splicing
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 184
Feature /change: G -> R
Diagnosis HAE
//
ID G184R(3a); standard; MUTATION;
Accession S0052
Systematic name g.3876G>A, c.550G>A, r.550g>a, p.Gly184Arg
Original code Kindred 2(1)
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3876
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 610
Feature /codon: ggg -> agg; 1
Feature /note: mutation may also lead to aberrant splicing
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 184
Feature /change: G -> R
Diagnosis HAE Type I
Relative SERPING1base; S0053
Relative SERPING1base; S0054
//
ID G184R(3b); standard; MUTATION;
Accession S0053
Systematic name g.3876G>A, c.550G>A, r.550g>a, p.Gly184Arg
Original code Kindred 2(2)
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3876
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 610
Feature /codon: ggg -> agg; 1
Feature /note: mutation may also lead to aberrant splicing
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 184
Feature /change: G -> R
Diagnosis HAE Type I
Relative SERPING1base; S0052
Relative SERPING1base; S0054
//
ID G184R(3c); standard; MUTATION;
Accession S0054
Systematic name g.3876G>A, c.550G>A, r.550g>a, p.Gly184Arg
Original code Kindred 2(3)
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3876
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 610
Feature /codon: ggg -> agg; 1
Feature /note: mutation may also lead to aberrant splicing
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 184
Feature /change: G -> R
Diagnosis HAE Type I
Relative SERPING1base; S0052
Relative SERPING1base; S0053
//
ID G184R(4a); standard; MUTATION;
Accession S0055
Systematic name g.3876G>A, c.550G>A, r.550g>a, p.Gly184Arg
Original code Kindred 3(1)
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3876
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 610
Feature /codon: ggg -> agg; 1
Feature /note: mutation may also lead to aberrant splicing
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 184
Feature /change: G -> R
Diagnosis HAE Type I
Relative SERPING1base; S0056
//
ID G184R(4b); standard; MUTATION;
Accession S0056
Systematic name g.3876G>A, c.550G>A, r.550g>a, p.Gly184Arg
Original code Kindred 3(2)
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3876
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 610
Feature /codon: ggg -> agg; 1
Feature /note: mutation may also lead to aberrant splicing
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 184
Feature /change: G -> R
Diagnosis HAE Type I
Relative SERPING1base; S0055
//
ID G184R(5); standard; MUTATION;
Accession S0057
Systematic name g.3876G>A, c.550G>A, r.550g>a, p.Gly184Arg
Original code Kindred 4
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3876
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 610
Feature /codon: ggg -> agg; 1
Feature /note: mutation may also lead to aberrant splicing
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 184
Feature /change: G -> R
Diagnosis HAE Type I
//
ID G184R(6); standard; MUTATION;
Accession S0115
Systematic name g.3876G>A, c.550G>A, r.550g>a, p.Gly184Arg
Original code Patient 101
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11112899
RefAuthors Pappalardo, E., Cicardi, M., Duponchel, C., Carugati, A.,
RefAuthors Choquet, S., Agostoni, A., Tosi, M.
RefTitle Frequent de novo mutations and exon deletions in the
RefTitle C1inhibitor gene of patients with angioedema.
RefLoc J Allergy Clin Immunol 106:1147-1154 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3876
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 610
Feature /codon: ggg -> agg; 1
Feature /note: mutation may also lead to aberrant splicing
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 184
Feature /change: G -> R
Diagnosis HAE
//
ID G184R(7); standard; MUTATION;
Accession S0119
Systematic name g.3876G>A, c.550G>A, r.550g>a, p.Gly184Arg
Original code Patient 151
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11112899
RefAuthors Pappalardo, E., Cicardi, M., Duponchel, C., Carugati, A.,
RefAuthors Choquet, S., Agostoni, A., Tosi, M.
RefTitle Frequent de novo mutations and exon deletions in the
RefTitle C1inhibitor gene of patients with angioedema.
RefLoc J Allergy Clin Immunol 106:1147-1154 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3876
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 610
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 184
Feature /change: G -> R
Diagnosis HAE
//
ID G184R(8); standard; MUTATION;
Accession S0212
Systematic name g.3876G>A, c.550G>A, r.550g>a, p.Gly184Arg
Original code AS
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3876
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 610
Feature /codon: ggg -> agg; 1
Feature /note: mutation may also lead to aberrant splicing
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 184
Feature /change: G -> R
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID G184R(9); standard; MUTATION;
Accession S0213
Systematic name g.3876G>A, c.550G>A, r.550g>a, p.Gly184Arg
Original code AZ
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3876
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 610
Feature /codon: ggg -> agg; 1
Feature /note: mutation may also lead to aberrant splicing
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 184
Feature /change: G -> R
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
Family history De novo
//
ID G184R(10); standard; MUTATION;
Accession S0214
Systematic name g.3876G>A, c.550G>A, r.550g>a, p.Gly184Arg
Original code BI
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3876
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 610
Feature /codon: ggg -> agg; 1
Feature /note: mutation may also lead to aberrant splicing
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 184
Feature /change: G -> R
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID G184R(11); standard; MUTATION;
Accession S0215
Systematic name g.3876G>A, c.550G>A, r.550g>a, p.Gly184Arg
Original code BP
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3876
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 610
Feature /codon: ggg -> agg; 1
Feature /note: mutation may also lead to aberrant splicing
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 184
Feature /change: G -> R
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID G184R(12); standard; MUTATION;
Accession S0216
Systematic name g.3876G>C, c.550G>C, r.550g>c, p.Gly184Arg
Original code U
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3876
Feature /change: g -> c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 610
Feature /codon: ggg -> cgg; 1
Feature /note: mutation may also lead to aberrant splicing
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 184
Feature /change: G -> R
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID #T191X210(1a); standard; MUTATION;
Accession S0060
Systematic name g.5553delA, c.571delA, r.571dela, p.Thr191fsX20
Original code Kindred 6(1)
Description A frame shift deletion mutation in the exon 4 leading to a
Description premature stop codon
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 5553
Feature /change: -a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 631
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 191
Feature /change: T -> QTWRASSLTP RTSPVSTRPX
Diagnosis HAE Type I
Relative SERPING1base; S0061
//
ID #T191X210(1b); standard; MUTATION;
Accession S0061
Systematic name g.5553delA, c.571delA, r.571dela, p.Thr191fsX20
Original code Kindred 6(2)
Description A frame shift deletion mutation in the exon 4 leading to a
Description premature stop codon
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 5553
Feature /change: -a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 631
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 191
Feature /change: T -> QTWRASSLTP RTSPVSTRPX
Diagnosis HAE Type I
Relative SERPING1base; S0060
//
ID @T191X256(1); standard; MUTATION;
Accession S0039
Systematic name g.5553dupA, c.571dupA, r.571dupa, p.Thr191fsX66
Original code C:21
Description A frame shift duplication mutation in the exon 4 leading
Description to a premature stop codon
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0077: 5554
Feature /change: +a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 632
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 191
Feature /change: T ->
Feature /change: NKPGEHPLLP QGLHLCPPGP EGLHDQRCHL SLSDLPQPRP
Feature /change: GHKGHLCECL SDPVQQQPQS PKQQQX
Diagnosis HAE Type I
//
ID L193P(1); standard; MUTATION;
Accession S0222
Systematic name g.5560T>C, c.578T>C, r.578u>c, p.Leu193Pro
Original code BM
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 5560
Feature /change: t -> c
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 638
Feature /codon: ctg -> ccg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 193
Feature /change: L -> P
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID Y199N(1); standard; MUTATION;
Accession S0223
Systematic name g.5577T>A, c.595T>A, r.595u>a, p.Tyr199Asn
Original code L
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 5577
Feature /change: t -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 655
Feature /codon: tac -> aac; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 199
Feature /change: Y -> N
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID #P200X210(1); standard; MUTATION;
Accession S0040
Systematic name g.5582delC, c.600delC, r.600delc, p.Lys201fsX10
Original code C:16
Description A frame shift deletion mutation in the exon 4 leading to a
Description premature stop codon
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 5582
Feature /change: -c
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 660
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 200
Feature /change: P -> PRTSPVSTRP X
Diagnosis HAE Type I
//
ID C205Y(1a); standard; MUTATION;
Accession S0062
Systematic name g.5596G>A, c.614G>A, r.614g>a, p.Cys205Tyr
Original code Kindred 7(1)
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 5596
Feature /change: g -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 674
Feature /codon: tgt -> tat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 205
Feature /change: C -> Y
Diagnosis HAE Type I
Relative SERPING1base; S0063
Relative SERPING1base; S0064
//
ID C205Y(1b); standard; MUTATION;
Accession S0063
Systematic name g.5596G>A, c.614G>A, r.614g>a, p.Cys205Tyr
Original code Kindred 7(2)
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 5596
Feature /change: g -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 674
Feature /codon: tgt -> tat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 205
Feature /change: C -> Y
Diagnosis HAE Type I
Relative SERPING1base; S0062
Relative SERPING1base; S0064
//
ID C205Y(1c); standard; MUTATION;
Accession S0064
Systematic name g.5596G>A, c.614G>A, r.614g>a, p.Cys205Tyr
Original code Kindred 7(3)
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 5596
Feature /change: g -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 674
Feature /codon: tgt -> tat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 205
Feature /change: C -> Y
Diagnosis HAE Type I
Relative SERPING1base; S0062
Relative SERPING1base; S0063
//
ID #Q208X210(1); standard; MUTATION;
Accession S0224
Systematic name g.5604delC, c.622delC, r.622delc, p.Gln208fsX3
Original code V
Description A frame shift deletion mutation in the exon 4 leading to a
Description premature stop codon
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 5604
Feature /change: -c
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 682
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 208
Feature /change: Q -> RPX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID L210X(1); standard; MUTATION;
Accession S0065
Systematic name g.5610delC, c.628delC, r.628delc, p.Leu210X
Original code Kindred 8
Description A deletion mutation in the exon 4 leading to a premature
Description stop codon
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 5610
Feature /change: -c
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 688
Feature /codon: ctg -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 210
Feature /change: L -> X
Diagnosis HAE Type I
//
ID V218D(1a); standard; MUTATION;
Accession S0066
Systematic name g.5635delT, c.653delT, r.653delu, p.Val218Asp
Original code Kindred 9(1)
Description A deletion mutation in the exon 4 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 5635
Feature /change: t -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 713
Feature /codon: gtc -> gac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 218
Feature /change: V -> D
Diagnosis HAE Type I
Relative SERPING1base; S0067
Relative SERPING1base; S0068
//
ID V218D(1b); standard; MUTATION;
Accession S0067
Systematic name g.5635delT, c.653delT, r.653delu, p.Val218Asp
Original code Kindred 9(2)
Description A deletion mutation in the exon 4 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 5635
Feature /change: t -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 713
Feature /codon: gtc -> gac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 218
Feature /change: V -> D
Diagnosis HAE Type I
Relative SERPING1base; S0066
Relative SERPING1base; S0068
//
ID V218D(1c); standard; MUTATION;
Accession S0068
Systematic name g.5635delT, c.653delT, r.653delu, p.Val218Asp
Original code Kindred 9(3)
Description A deletion mutation in the exon 4 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 5635
Feature /change: t -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 713
Feature /codon: gtc -> gac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 218
Feature /change: V -> D
Diagnosis HAE Type I
Relative SERPING1base; S0066
Relative SERPING1base; S0067
//
ID @V221X256(1); standard; MUTATION;
Accession S0069
Systematic name g.5642dupA, c.660dupA, r.660dupa, p.Val221fsX36
Original code Kindred 10
Description A frame shift duplication mutation in the exon 4 leading
Description to a premature stop codon
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0077: 5643
Feature /change: +a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 721
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 221
Feature /change: V -> SLSDLPQPRP GHKGHLCECL SDPVQQQPQS PKQQQX
Diagnosis HAE Type I
//
ID Q223X(1); standard; MUTATION;
Accession S0160
Systematic name g.5649C>T, c.667C>T, r.667c>u, p.Gln223X
Description A point mutation in the exon 4 leading to a premature stop
Description codon
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 5649
Feature /change: c -> t
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 727
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 223
Feature /change: Q -> X
Diagnosis HAE Type I
Ethnic origin Caucasoid; Hungary
//
ID I224S(1); standard; MUTATION;
Accession S0225
Systematic name g.5653T>G, c.671T>G, r.671u>g, p.Ile224Ser
Original code AF
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 5653
Feature /change: t -> g
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 731
Feature /codon: atc -> agc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 224
Feature /change: I -> S
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID V288E(1); standard; MUTATION;
Accession S0231
Systematic name g.9684_9684delinsAA, c.863_864delinsAA, r.863_864delinsaa,
Systematic name p.Val288Glu
Original code BZ
Description A complex mutation in the exon 5 leading to an amino acid
Description change
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: complex
Feature /loc: IDRefSeq: D0077: 9684..9685
Feature /change: tc -> aa
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 923..924
Feature /codon: gtc -> gaa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 288
Feature /change: V -> E
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID F236S(1); standard; MUTATION;
Accession S0025
Systematic name g.9528T>C, c.707T>C, r.707u>c, p.Phe236Ser
Original code D:26
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 9528
Feature /change: t -> c
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 767
Feature /codon: ttt -> tct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 236
Feature /change: F -> S
Diagnosis HAE Type I
//
ID #Y244X251(1); standard; MUTATION;
Accession S0117
Systematic name g.9552_9553delinsT, c.731_732delinsT, r.731_732delinsu,
Systematic name p.Tyr244fsX8
Original code Patient 131
Description A frame shift indel mutation in the exon 5 leading to a
Description premature stop codon
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11112899
RefAuthors Pappalardo, E., Cicardi, M., Duponchel, C., Carugati, A.,
RefAuthors Choquet, S., Agostoni, A., Tosi, M.
RefTitle Frequent de novo mutations and exon deletions in the
RefTitle C1inhibitor gene of patients with angioedema.
RefLoc J Allergy Clin Immunol 106:1147-1154 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0077: 9552..9553
Feature /change: ac -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077:
Feature /loc: 791..792
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 244
Feature /change: Y -> LAAAPESX
Diagnosis HAE
//
ID P248R(1); standard; MUTATION;
Accession S0227
Systematic name g.9564C>G, c.743C>G, r.743c>g, p.Pro248Arg
Original code BO
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 9564
Feature /change: c -> g
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 803
Feature /codon: ccc -> cgc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 248
Feature /change: P -> R
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID #P248X251(1); standard; MUTATION;
Accession S0026
Systematic name g.9565delC, c.744delC, r.744delc, p.Arg249fsX3
Original code D:9
Description A frame shift deletion mutation in the exon 5 leading to a
Description premature stop codon
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 9565
Feature /change: -c
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 804
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 248
Feature /change: P -> PESX
Diagnosis HAE Type I
//
ID L251X(1); standard; MUTATION;
Accession S0027
Systematic name g.9572delC, c.751delC, r.751delc, p.Leu251X
Original code D:41
Description A deletion mutation in the exon 5 leading to a premature
Description stop codon
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 9572
Feature /change: -c
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 811
Feature /codon: cta -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 251
Feature /change: L -> X
Diagnosis HAE Type I
//
ID Upstream/#N272-1(1); standard; MUTATION;
Accession S0028
Systematic name g.9637_9639delCAA, c.816_818delCAA, r.816_818delcaa,
Systematic name p.Asn272del
Original code D:31
Description A point mutation in the promoter region 40 bp to
Description upstream from cDNA start point and an inframe deletion in
Description the exon 5 leading to an amino acid change
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 3
Feature /name: point
Feature /loc: IDRefSeq: D0077: 1142
Feature /change: c -> g
Feature /genomic_region: 5' UTR
Feature /genomic_region: promoter
Feature dna; 2
Feature /rnalink: 4
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 9637..9639
Feature /change: -caa
Feature /genomic_region: exon; 5
Feature rna; 3
Feature /dnalink: 1
Feature /aalink: 5
Feature /name: upstream
Feature rna; 4
Feature /dnalink: 2
Feature /aalink: 6
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0077:
Feature /loc: 876..878
Feature aa; 5
Feature /rnalink: 3
Feature /name: unknown
Feature aa; 6
Feature /rnalink: 4
Feature /name: deletion; inframe
Feature /loc: UniProt: P05155; IC1_HUMAN: 272..273
Feature /change: NK -> K
Diagnosis HAE Type I
//
ID E260X(1); standard; MUTATION;
Accession S0228
Systematic name g.9599G>T, c.778G>T, r.778g>u, p.Glu260X
Original code AT
Description A point mutation in the exon 5 leading to a premature stop
Description codon
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 9599
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 838
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 260
Feature /change: E -> X
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID W265X(1); standard; MUTATION;
Accession S0229
Systematic name g.9616G>A, c.795G>A, r.795g>a, p.Trp265X
Original code K
Description A point mutation in the exon 5 leading to a premature stop
Description codon
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 9616
Feature /change: g -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 855
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 265
Feature /change: W -> X
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID @T270X280(1); standard; MUTATION;
Accession S0080
Systematic name g.9626_9630dup, c.805_809dup, r.805_809dup, p.Asn271fsX10
Original code Bo
Description A frame shift duplication mutation in the exon 5 leading
Description to a premature stop codon
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 7937817
RefAuthors Bissler, J. J., Cicardi, M., Donaldson, V. H., Gatenby,
RefAuthors P. A., Rosen, F. S., Sheffer, A. L., Davis, A. E.
RefTitle A cluster of mutations within a short triplet repeat in
RefTitle the C1 inhibitor gene.
RefLoc Proc Natl Acad Sci U S A 91:9622-9625 (1994)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0077: 9631
Feature /change: +aacac
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 870
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 270
Feature /change: T -> TTPTTRSAGC X
Diagnosis HAE Type I
//
ID #N272-1(1); standard; MUTATION;
Accession S0081
Systematic name g.9637_9639delCAA, c.816_818delCAA, r.816_818delcaa,
Systematic name p.Asn272del
Original code Le
Description An inframe deletion in the exon 5 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 7937817
RefAuthors Bissler, J. J., Cicardi, M., Donaldson, V. H., Gatenby,
RefAuthors P. A., Rosen, F. S., Sheffer, A. L., Davis, A. E.
RefTitle A cluster of mutations within a short triplet repeat in
RefTitle the C1 inhibitor gene.
RefLoc Proc Natl Acad Sci U S A 91:9622-9625 (1994)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 9637..9639
Feature /change: -caa
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0077:
Feature /loc: 876..878
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P05155; IC1_HUMAN: 272..273
Feature /change: NK -> K
Diagnosis HAE Type I
//
ID #N272-1(2); standard; MUTATION;
Accession S0230
Systematic name g.9637_9639delCAA, c.816_818delCAA, r.816_818delcaa,
Systematic name p.Asn272del
Original code AJ
Description An inframe deletion in the exon 5 leading to an amino acid
Description change
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 9637..9639
Feature /change: -caa
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0077: 876..878
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P05155; IC1_HUMAN: 272..273
Feature /change: NK -> K
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID #K273-1(1a); standard; MUTATION;
Accession S0070
Systematic name g.9638_9640delAAG, c.817_819delAAG, r.817_819delaag,
Systematic name p.Lys273del
Original code Kindred 11(1)
Description An inframe deletion in the exon 5 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 9638..9640
Feature /change: -aag
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0077:
Feature /loc: 877..879
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P05155; IC1_HUMAN: 273
Feature /change: -K
Diagnosis HAE Type II
Relative SERPING1base; S0071
//
ID #K273-1(1b); standard; MUTATION;
Accession S0071
Systematic name g.9638_9640delAAG, c.817_819delAAG, r.817_819delaag,
Systematic name p.Lys273del
Original code Kindred 11(2)
Description An inframe deletion in the exon 5 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 9638..9640
Feature /change: -aag
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0077:
Feature /loc: 877..879
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P05155; IC1_HUMAN: 273
Feature /change: -K
Diagnosis HAE Type II
Relative SERPING1base; S0070
//
ID #K273-1(2); standard; MUTATION;
Accession S0079
Systematic name g.9638_9640delAAG, c.817_819delAAG, r.817_819delaag,
Systematic name p.Lys273del
Original code Ta
Description An inframe deletion in the exon 5 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2118657
RefAuthors Parad, R. B., Kramer, J., Strunk, R. C., Rosen, F. S.,
RefAuthors Davis, A. E.
RefTitle Dysfunctional C1 inhibitor ta: deletion of lys-251
RefTitle results in acquisition of an N-glycosylation site.
RefLoc Proc Natl Acad Sci U S A 87:6786-6790 (1990)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 9638..9640
Feature /change: -aag
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0077:
Feature /loc: 877..879
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P05155; IC1_HUMAN: 273
Feature /change: -K
Diagnosis HAE Type II
Family history Inherited
//
ID #K273-1(3); standard; MUTATION;
Accession S0082
Systematic name g.9639_9641delAGA, c.818_820delAGA, r.818_820delaga,
Systematic name p.Lys273del
Original code Cr
Description An inframe deletion in the exon 5 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 7937817
RefAuthors Bissler, J. J., Cicardi, M., Donaldson, V. H., Gatenby,
RefAuthors P. A., Rosen, F. S., Sheffer, A. L., Davis, A. E.
RefTitle A cluster of mutations within a short triplet repeat in
RefTitle the C1 inhibitor gene.
RefLoc Proc Natl Acad Sci U S A 91:9622-9625 (1994)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 9639..9641
Feature /change: -aga
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0077:
Feature /loc: 878..880
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P05155; IC1_HUMAN: 273..274
Feature /change: KI -> I
Diagnosis HAE Type II
//
ID I274V(1); standard; MUTATION;
Accession S0072
Systematic name g.9641A>G, c.820A>G, r.820a>g, p.Ile274Val
Original code Kindred 12
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 9641
Feature /change: a -> g
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 880
Feature /codon: atc -> gtc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 274
Feature /change: I -> V
Diagnosis HAE Type I
//
ID #T285X303(1a); standard; MUTATION;
Accession S0100
Systematic name g.9675_9676delCC, c.854_855delCC, r.854_855delcc,
Systematic name p.Arg286fsX18
Description A frame shift deletion mutation in the exon 5 leading to a
Description premature stop codon
Date 03-Aug-2004 (Rel. 1, Created)
Date 03-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11933207
RefAuthors Freiberger, T., Kolarova, L., Mejstrik, P., Vyskocilova,
RefAuthors M., Kuklinek, P., Litzman, J.
RefTitle Five novel mutations in the C1 inhibitor gene (C1NH)
RefTitle leading to a premature stop codon in patients with type I
RefTitle hereditary angioedema.
RefLoc Hum Mutat 19:461 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 9675..9676
Feature /change: -cc
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077:
Feature /loc: 914..915
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 285
Feature /change: T -> TPCPPQCYLP ECQVEDNIX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Czech
Family history Inherited
Relative SERPING1base; S0101
//
ID #T285X303(1b); standard; MUTATION;
Accession S0101
Systematic name g.9675_9676delCC, c.854_855delCC, r.854_855delcc,
Systematic name p.Arg286fsX18
Description A frame shift deletion mutation in the exon 5 leading to a
Description premature stop codon
Date 03-Aug-2004 (Rel. 1, Created)
Date 03-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11933207
RefAuthors Freiberger, T., Kolarova, L., Mejstrik, P., Vyskocilova,
RefAuthors M., Kuklinek, P., Litzman, J.
RefTitle Five novel mutations in the C1 inhibitor gene (C1NH)
RefTitle leading to a premature stop codon in patients with type I
RefTitle hereditary angioedema.
RefLoc Hum Mutat 19:461 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 9675..9676
Feature /change: -cc
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077:
Feature /loc: 914..915
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 285
Feature /change: T -> TPCPPQCYLP ECQVEDNIX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Czech
Family history Inherited
Relative SERPING1base; S0100
//
ID I293T(1); standard; MUTATION;
Accession S0108
Systematic name g.9699T>C, c.878T>C, r.878u>c, p.Ile293Thr
Original code Patient 21
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11112899
RefAuthors Pappalardo, E., Cicardi, M., Duponchel, C., Carugati, A.,
RefAuthors Choquet, S., Agostoni, A., Tosi, M.
RefTitle Frequent de novo mutations and exon deletions in the
RefTitle C1inhibitor gene of patients with angioedema.
RefLoc J Allergy Clin Immunol 106:1147-1154 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 9699
Feature /change: t -> c
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 938
Feature /codon: atc -> acc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 293
Feature /change: I -> T
Diagnosis HAE
//
ID #I293X294(1a); standard; MUTATION;
Accession S0261
Systematic name g.9699_9702delTCTA, c.878_881delTCTA, r.878_881delucua,
Systematic name p.Ile293fsX2
Original code II.2
Description A frame shift deletion mutation in the exon 5 leading to a
Description premature stop codon
Date 02-May-2007 (Rel. 1, Created)
Date 02-May-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16529817
RefAuthors Monnier, N., Ponard, D., Duponchel, C., Csopaki, F.,
RefAuthors Bouillet, L., Tosi, M., Lunardi, J., Drouet, C.
RefTitle Characterisation of a new C1 inhibitor mutant in a patient
RefTitle with hepatocellular carcinoma.
RefLoc Mol Immunol:2161-2168 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 9699..9702
Feature /change: -tcta
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 938..941
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 293..294
Feature /change: IY -> TX
Diagnosis HAE Type I
Protein exp. both the mutant transcript and the intracellular abnormal
Protein exp. C1-INH protein are unstable
Symptoms severe angioedema, hepatocellular carcinoma
Sex XX
Relative SERPING1base; S0262 daughter
Comment the patient was submitted to danazol therapy for 13 years
Comment before a hepatocellular carcinoma develops on a
Comment noncirrhotic liver at age 34 years
//
ID #I293X294(1b); standard; MUTATION;
Accession S0262
Systematic name g.9699_9702delTCTA, c.878_881delTCTA, r.878_881delucua,
Systematic name p.Ile293fsX2
Original code III.2
Description A frame shift deletion mutation in the exon 5 leading to a
Description premature stop codon
Date 02-May-2007 (Rel. 1, Created)
Date 02-May-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16529817
RefAuthors Monnier, N., Ponard, D., Duponchel, C., Csopaki, F.,
RefAuthors Bouillet, L., Tosi, M., Lunardi, J., Drouet, C.
RefTitle Characterisation of a new C1 inhibitor mutant in a patient
RefTitle with hepatocellular carcinoma.
RefLoc Mol Immunol:2161-2168 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 9699..9702
Feature /change: -tcta
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 938..941
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 293..294
Feature /change: IY -> TX
Diagnosis HAE Type I
Protein exp. both the mutant transcript and the intracellular abnormal
Protein exp. C1-INH protein are unstable
Sex XX
Family history Inherited
Relative SERPING1base; S0261 mother
//
ID L295R(1); standard; MUTATION;
Accession S0233
Systematic name g.9705T>G, c.884T>G, r.884u>g, p.Leu295Arg
Original code AN
Description A point mutation in the exon 5 leading to an amino acid
Description change or aberrant splicing
Date 25-Aug-2005 (Rel. 1, Created)
Date 25-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 3
Feature /name: point
Feature /loc: IDRefSeq: D0077: 9705
Feature /change: t -> g
Feature /genomic_region: exon; 5
Feature dna; 2
Feature /rnalink: 4
Feature /name: point
Feature /loc: IDRefSeq: D0077: 9705
Feature /change: t -> g
Feature /genomic_region: exon; 5
Feature rna; 3
Feature /dnalink: 1
Feature /aalink: 5
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 944
Feature /codon: ctg -> cgg; 2
Feature rna; 4
Feature /dnalink: 2
Feature /aalink: 6
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0077: 746..949
Feature /change: -acctggccat aagggacacc tttgtgaatg cctctcggac
Feature /change: cctgtacagc agcagcccca gagtcctaag caacaacagt
Feature /change: gacgccaact tggagctcat caacacctgg gtggccaaga
Feature /change: acaccaacaa caagatcagc cggctgctag acagtctgcc
Feature /change: ctccgatacc cgccttgtcc tcctcaatgc tatctacctg
Feature /change: agtg
Feature /note: also wild type mRNA detected
Feature aa; 5
Feature /rnalink: 3
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 295
Feature /change: L -> R
Feature aa; 6
Feature /rnalink: 4
Feature /name: deletion; inframe
Feature /loc: UniProt: P05155; IC1_HUMAN: 229..297
Feature /change: DLAIRDTFVN ASRTLYSSSP RVLSNNSDAN LELINTWVAK
Feature /change: NTNNKISRLL DSLPSDTRLV LLNAIYLSA
Feature /change: ->
Feature /change: A
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID #T302-1(1); standard; MUTATION;
Accession S0110
Systematic name g.9919_9921delACA, c.904_906delACA, r.904_906delaca,
Systematic name p.Thr302del
Original code Patient 51
Description An inframe deletion in the exon 6 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11112899
RefAuthors Pappalardo, E., Cicardi, M., Duponchel, C., Carugati, A.,
RefAuthors Choquet, S., Agostoni, A., Tosi, M.
RefTitle Frequent de novo mutations and exon deletions in the
RefTitle C1inhibitor gene of patients with angioedema.
RefLoc J Allergy Clin Immunol 106:1147-1154 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 9919..9921
Feature /change: -aca
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0077:
Feature /loc: 964..966
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P05155; IC1_HUMAN: 302
Feature /change: -T
Diagnosis HAE
//
ID F303C(1); standard; MUTATION;
Accession S0029
Systematic name g.9923T>G, c.908T>G, r.908u>g, p.Phe303Cys
Original code D:23
Description A point mutation in the exon 6 leading to an amino acid
Description change
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 9923
Feature /change: t -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 968
Feature /codon: ttt -> tgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 303
Feature /change: F -> C
Diagnosis HAE Type I
//
ID M325T(1); standard; MUTATION;
Accession S0030
Systematic name g.9989T>C, c.974T>C, r.974u>c, p.Met325Thr
Original code D:11
Description A point mutation in the exon 6 leading to an amino acid
Description change
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 9989
Feature /change: t -> c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1034
Feature /codon: atg -> acg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 325
Feature /change: M -> T
Diagnosis HAE Type I
//
ID M325T(2); standard; MUTATION;
Accession S0111
Systematic name g.9989T>C, c.974T>C, r.974u>c, p.Met325Thr
Original code Patient 61
Description A point mutation in the exon 6 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11112899
RefAuthors Pappalardo, E., Cicardi, M., Duponchel, C., Carugati, A.,
RefAuthors Choquet, S., Agostoni, A., Tosi, M.
RefTitle Frequent de novo mutations and exon deletions in the
RefTitle C1inhibitor gene of patients with angioedema.
RefLoc J Allergy Clin Immunol 106:1147-1154 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 9989
Feature /change: t -> c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1034
Feature /codon: atg -> acg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 325
Feature /change: M -> T
Diagnosis HAE
//
ID #S327X336(1); standard; MUTATION;
Accession S0031
Systematic name g.9996_9997delCA, c.981_982delCA, r.981_982delca,
Systematic name p.Ser327fsX10
Original code D:17
Description A frame shift deletion mutation in the exon 6 leading to a
Description premature stop codon
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 9996..9997
Feature /change: -ca
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077:
Feature /loc: 1041..1042
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 327..328
Feature /change: SK -> REVPCGPFHX
Diagnosis HAE Type I
//
ID @S327X341(1); standard; MUTATION;
Accession S0235
Systematic name g.9993_9994dup, c.978_979dup, r.978_979dup, p.Ser327fsX15
Original code DM
Description A frame shift duplication mutation in the exon 6 leading to
Description a premature stop codon
Date 25-Aug-2005 (Rel. 1, Created)
Date 25-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0077: 9995
Feature /change: +ta
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 1040
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 327
Feature /change: S -> IARSTLWPIS LTKLX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID Y330X(1); standard; MUTATION;
Accession S0032
Systematic name g.10005C>G, c.990C>G, r.990c>g, p.Tyr330X
Original code D:43
Description A point mutation in the exon 6 leading to a premature stop
Description codon
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 10005
Feature /change: c -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1050
Feature /codon: tac -> tag; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 330
Feature /change: Y -> X
Diagnosis HAE Type I
//
ID Y330X(2); standard; MUTATION;
Accession S0236
Systematic name g.10005C>G, c.990C>G, r.990c>g, p.Tyr330X
Original code AI
Description A point mutation in the exon 6 leading to a premature stop
Description codon
Date 25-Aug-2005 (Rel. 1, Created)
Date 25-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 10005
Feature /change: c -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1050
Feature /codon: tac -> tag; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 330
Feature /change: Y -> X
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID #V344X357(1); standard; MUTATION;
Accession S0005
Systematic name g.15213_15432del, c.1030_1249del, r.1030_1249del,
Systematic name p.Val344fsX14
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon
Date 19-May-2004 (Rel. 1, Created)
Date 19-May-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2723063
RefAuthors Ariga, T., Igarashi, T., Ramesh, N., Parad, R., Cicardi,
RefAuthors M., Davis, A. E.
RefTitle Type I C1 inhibitor deficiency with a small messenger RNA
RefTitle resulting from deletion of one exon.
RefLoc J Clin Invest 83:1888-1893 (1989)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 15213..15432
Feature /change: -gtggggcagc tgcagctctc ccacaatctg agtttggtga
Feature /change: tcctggtacc ccagaacctg aaacatcgtc ttgaagacat
Feature /change: ggaacaggct ctcagccctt ctgttttcaa ggccatcatg
Feature /change: gagaaactgg agatgtccaa gttccagccc actctcctaa
Feature /change: cactaccccg catcaaagtg acgaccagcc aggatatgct
Feature /change: ctcaatcatg gagaaattgg
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0077:
Feature /loc: 1090..1309
Feature /note: skipping of exon 7
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 344..417
Feature /change: VGQLQLSHNL SLVILVPQNL KHRLEDMEQA LSPSVFKAIM
Feature /change: EKLEMSKFQP TLLTLPRIKV TTSQDMLSIM EKLE
Feature /change: ->
Feature /change: NSSIFLMTLT CVGX
Diagnosis HAE Type I
Protein exp. the abnormal protein can't be detected in patient's serum
Sex XX
//
ID G345R(1); standard; MUTATION;
Accession S0237
Systematic name g.15216G>A, c.1033G>A, r.1033g>a, p.Gly345Arg
Original code T
Description A point mutation in the exon 7 leading to an amino acid
Description change
Date 25-Aug-2005 (Rel. 1, Created)
Date 25-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15216
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1093
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 345
Feature /change: G -> R
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID G345R(2a); standard; MUTATION;
Accession S0268
Systematic name g.15216G>A, c.1033G>A, r.1033g>a, p.Gly345Arg
Original code A1
Description A point mutation in the exon 7 leading to an amino acid
Description change
Date 23-May-2007 (Rel. 1, Created)
Date 23-May-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16409206
RefAuthors Kang, H. R., Yim, E. Y., Oh, S. Y., Chang, Y. S., Kim, Y.
RefAuthors K., Cho, S. H., Min, K. U., Kim, Y. Y.
RefTitle Normal C1 inhibitor mRNA expression level in type I
RefTitle hereditary angioedema patients: newly found C1 inhibitor
RefTitle gene mutations.
RefLoc Allergy:260-264 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15216
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1093
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 345
Feature /change: G -> R
Diagnosis HAE Type I
Symptoms Multiple episodes of self-limiting localized cutaneous
Symptoms swelling and abdominal pain for more than 10 years
Age 44
Sex XY
Ethnic origin Mongoloid; Korean
Family history Inherited
Relative SERPING1base; S0269 uncle
Relative SERPING1base; S0270 uncle
Relative SERPING1base; S0271 cousin
Relative SERPING1base; S0272 cousin
Relative SERPING1base; S0273 daughter
Relative SERPING1base; S0274 daughter
Relative SERPING1base; S0275 cousin
Relative SERPING1base; S0276 cousin
//
ID G345R(2b); standard; MUTATION;
Accession S0269
Systematic name g.15216G>A, c.1033G>A, r.1033g>a, p.Gly345Arg
Original code A4
Description A point mutation in the exon 7 leading to an amino acid
Description change
Date 23-May-2007 (Rel. 1, Created)
Date 23-May-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16409206
RefAuthors Kang, H. R., Yim, E. Y., Oh, S. Y., Chang, Y. S., Kim, Y.
RefAuthors K., Cho, S. H., Min, K. U., Kim, Y. Y.
RefTitle Normal C1 inhibitor mRNA expression level in type I
RefTitle hereditary angioedema patients: newly found C1 inhibitor
RefTitle gene mutations.
RefLoc Allergy:260-264 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15216
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1093
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 345
Feature /change: G -> R
Diagnosis HAE Type I
Sex XY
Ethnic origin Mongoloid; Korean
Family history Inherited
Relative SERPING1base; S0268 nephew
Relative SERPING1base; S0270 brother
Relative SERPING1base; S0271 niece
Relative SERPING1base; S0272 niece
Relative SERPING1base; S0273 grand niece
Relative SERPING1base; S0274 grand niece
Relative SERPING1base; S0275 son
Relative SERPING1base; S0276 daughter
//
ID G345R(2c); standard; MUTATION;
Accession S0270
Systematic name g.15216G>A, c.1033G>A, r.1033g>a, p.Gly345Arg
Original code A5
Description A point mutation in the exon 7 leading to an amino acid
Description change
Date 23-May-2007 (Rel. 1, Created)
Date 23-May-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16409206
RefAuthors Kang, H. R., Yim, E. Y., Oh, S. Y., Chang, Y. S., Kim, Y.
RefAuthors K., Cho, S. H., Min, K. U., Kim, Y. Y.
RefTitle Normal C1 inhibitor mRNA expression level in type I
RefTitle hereditary angioedema patients: newly found C1 inhibitor
RefTitle gene mutations.
RefLoc Allergy:260-264 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15216
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1093
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 345
Feature /change: G -> R
Diagnosis HAE Type I
Sex XY
Ethnic origin Mongoloid; Korean
Family history Inherited
Relative SERPING1base; S0268 nephew
Relative SERPING1base; S0269 brother
Relative SERPING1base; S0271 daughter
Relative SERPING1base; S0272 daughter
Relative SERPING1base; S0273 grand niece
Relative SERPING1base; S0274 grand niece
Relative SERPING1base; S0275 nephew
Relative SERPING1base; S0276 niece
//
ID G345R(2d); standard; MUTATION;
Accession S0271
Systematic name g.15216G>A, c.1033G>A, r.1033g>a, p.Gly345Arg
Original code A8
Description A point mutation in the exon 7 leading to an amino acid
Description change
Date 23-May-2007 (Rel. 1, Created)
Date 23-May-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16409206
RefAuthors Kang, H. R., Yim, E. Y., Oh, S. Y., Chang, Y. S., Kim, Y.
RefAuthors K., Cho, S. H., Min, K. U., Kim, Y. Y.
RefTitle Normal C1 inhibitor mRNA expression level in type I
RefTitle hereditary angioedema patients: newly found C1 inhibitor
RefTitle gene mutations.
RefLoc Allergy:260-264 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15216
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1093
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 345
Feature /change: G -> R
Diagnosis HAE Type I
Sex XX
Ethnic origin Mongoloid; Korean
Family history Inherited
Relative SERPING1base; S0268 cousin
Relative SERPING1base; S0269 uncle
Relative SERPING1base; S0270 father
Relative SERPING1base; S0272 sister
Relative SERPING1base; S0273 second cousin
Relative SERPING1base; S0274 second cousin
Relative SERPING1base; S0275 cousin
Relative SERPING1base; S0276 cousin
//
ID G345R(2e); standard; MUTATION;
Accession S0272
Systematic name g.15216G>A, c.1033G>A, r.1033g>a, p.Gly345Arg
Original code A9
Description A point mutation in the exon 7 leading to an amino acid
Description change
Date 23-May-2007 (Rel. 1, Created)
Date 23-May-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16409206
RefAuthors Kang, H. R., Yim, E. Y., Oh, S. Y., Chang, Y. S., Kim, Y.
RefAuthors K., Cho, S. H., Min, K. U., Kim, Y. Y.
RefTitle Normal C1 inhibitor mRNA expression level in type I
RefTitle hereditary angioedema patients: newly found C1 inhibitor
RefTitle gene mutations.
RefLoc Allergy:260-264 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15216
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1093
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 345
Feature /change: G -> R
Diagnosis HAE Type I
Sex XX
Ethnic origin Mongoloid; Korean
Family history Inherited
Relative SERPING1base; S0268 cousin
Relative SERPING1base; S0269 uncle
Relative SERPING1base; S0270 father
Relative SERPING1base; S0271 sister
Relative SERPING1base; S0273 second cousin
Relative SERPING1base; S0274 second cousin
Relative SERPING1base; S0275 cousin
Relative SERPING1base; S0276 cousin
//
ID G345R(2f); standard; MUTATION;
Accession S0273
Systematic name g.15216G>A, c.1033G>A, r.1033g>a, p.Gly345Arg
Original code A2
Description A point mutation in the exon 7 leading to an amino acid
Description change
Date 23-May-2007 (Rel. 1, Created)
Date 23-May-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16409206
RefAuthors Kang, H. R., Yim, E. Y., Oh, S. Y., Chang, Y. S., Kim, Y.
RefAuthors K., Cho, S. H., Min, K. U., Kim, Y. Y.
RefTitle Normal C1 inhibitor mRNA expression level in type I
RefTitle hereditary angioedema patients: newly found C1 inhibitor
RefTitle gene mutations.
RefLoc Allergy:260-264 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15216
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1093
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 345
Feature /change: G -> R
Diagnosis HAE Type I
Sex XX
Ethnic origin Mongoloid; Korean
Family history Inherited
Relative SERPING1base; S0268 father
Relative SERPING1base; S0269 grand uncle
Relative SERPING1base; S0270 grand uncle
Relative SERPING1base; S0271 first cousin once removed
Relative SERPING1base; S0272 first cousin once removed
Relative SERPING1base; S0274 sister
Relative SERPING1base; S0275 first cousin once removed
Relative SERPING1base; S0276 first cousin once removed
//
ID G345R(2g); standard; MUTATION;
Accession S0274
Systematic name g.15216G>A, c.1033G>A, r.1033g>a, p.Gly345Arg
Original code A3
Description A point mutation in the exon 7 leading to an amino acid
Description change
Date 23-May-2007 (Rel. 1, Created)
Date 23-May-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16409206
RefAuthors Kang, H. R., Yim, E. Y., Oh, S. Y., Chang, Y. S., Kim, Y.
RefAuthors K., Cho, S. H., Min, K. U., Kim, Y. Y.
RefTitle Normal C1 inhibitor mRNA expression level in type I
RefTitle hereditary angioedema patients: newly found C1 inhibitor
RefTitle gene mutations.
RefLoc Allergy:260-264 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15216
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1093
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 345
Feature /change: G -> R
Diagnosis HAE Type I
Sex XX
Ethnic origin Mongoloid; Korean
Family history Inherited
Relative SERPING1base; S0268 father
Relative SERPING1base; S0269 grand uncle
Relative SERPING1base; S0270 grand uncle
Relative SERPING1base; S0271 first cousin once removed
Relative SERPING1base; S0272 first cousin once removed
Relative SERPING1base; S0273 sister
Relative SERPING1base; S0275 first cousin once removed
Relative SERPING1base; S0276 first cousin once removed
//
ID G345R(2h); standard; MUTATION;
Accession S0275
Systematic name g.15216G>A, c.1033G>A, r.1033g>a, p.Gly345Arg
Original code A10
Description A point mutation in the exon 7 leading to an amino acid
Description change
Date 23-May-2007 (Rel. 1, Created)
Date 23-May-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16409206
RefAuthors Kang, H. R., Yim, E. Y., Oh, S. Y., Chang, Y. S., Kim, Y.
RefAuthors K., Cho, S. H., Min, K. U., Kim, Y. Y.
RefTitle Normal C1 inhibitor mRNA expression level in type I
RefTitle hereditary angioedema patients: newly found C1 inhibitor
RefTitle gene mutations.
RefLoc Allergy:260-264 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15216
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1093
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 345
Feature /change: G -> R
Diagnosis HAE Type I
Sex XY
Ethnic origin Mongoloid; Korean
Family history Inherited
Relative SERPING1base; S0268 cousin
Relative SERPING1base; S0269 father
Relative SERPING1base; S0270 uncle
Relative SERPING1base; S0271 cousin
Relative SERPING1base; S0272 cousin
Relative SERPING1base; S0273 first cousin once removed
Relative SERPING1base; S0274 first cousin once removed
Relative SERPING1base; S0276 sister
//
ID G345R(2i); standard; MUTATION;
Accession S0276
Systematic name g.15216G>A, c.1033G>A, r.1033g>a, p.Gly345Arg
Original code A7
Description A point mutation in the exon 7 leading to an amino acid
Description change
Date 23-May-2007 (Rel. 1, Created)
Date 23-May-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16409206
RefAuthors Kang, H. R., Yim, E. Y., Oh, S. Y., Chang, Y. S., Kim, Y.
RefAuthors K., Cho, S. H., Min, K. U., Kim, Y. Y.
RefTitle Normal C1 inhibitor mRNA expression level in type I
RefTitle hereditary angioedema patients: newly found C1 inhibitor
RefTitle gene mutations.
RefLoc Allergy:260-264 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15216
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1093
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 345
Feature /change: G -> R
Diagnosis HAE Type I
Sex XX
Ethnic origin Mongoloid; Korean
Family history Inherited
Relative SERPING1base; S0268 cousin
Relative SERPING1base; S0269 father
Relative SERPING1base; S0270 uncle
Relative SERPING1base; S0271 cousin
Relative SERPING1base; S0272 cousin
Relative SERPING1base; S0273 first cousin once removed
Relative SERPING1base; S0274 first cousin once removed
Relative SERPING1base; S0275 brother
//
ID Q346X(1); standard; MUTATION;
Accession S0044
Systematic name g.15219C>T, c.1036C>T, r.1036c>u, p.Gln346X
Original code E:35
Description A point mutation in the exon 7 leading to a premature stop
Description codon
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15219
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1096
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 346
Feature /change: Q -> X
Diagnosis HAE Type I
//
ID #I357X363(1); standard; MUTATION;
Accession S0107
Systematic name g.15252delA, c.1069delA, r.1069dela, p.Ile357fsX7
Original code Patient 11
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11112899
RefAuthors Pappalardo, E., Cicardi, M., Duponchel, C., Carugati, A.,
RefAuthors Choquet, S., Agostoni, A., Tosi, M.
RefTitle Frequent de novo mutations and exon deletions in the
RefTitle C1inhibitor gene of patients with angioedema.
RefLoc J Allergy Clin Immunol 106:1147-1154 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 15252
Feature /change: -a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 1129
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 357
Feature /change: I -> SWYPRTX
Diagnosis HAE
//
ID Q361X(1a); standard; MUTATION;
Accession S0083
Systematic name g.15264C>T, c.1081C>T, r.1081c>u, p.Gln361X
Description A point mutation in the exon 7 leading to a premature stop
Description codon
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8792821
RefAuthors Ono, H., Kawaguchi, H., Ishii, N., Nakajima, H.
RefTitle A point mutation in exon 7 of the C1-inhibitor gene
RefTitle causing type I hereditary angioedema.
RefLoc Hum Genet 98:452-453 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15264
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1141
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 361
Feature /change: Q -> X
Diagnosis HAE Type I
Sex XY
Ethnic origin Mongoloid; Japan
Family history Inherited
Relative SERPING1base; S0084 sister
Relative SERPING1base; S0085 son
Relative SERPING1base; S0086 son
Relative SERPING1base; S0087 grandson
//
ID Q361X(1b); standard; MUTATION;
Accession S0084
Systematic name g.15264C>T, c.1081C>T, r.1081c>u, p.Gln361X
Description A point mutation in the exon 7 leading to a premature stop
Description codon
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8792821
RefAuthors Ono, H., Kawaguchi, H., Ishii, N., Nakajima, H.
RefTitle A point mutation in exon 7 of the C1-inhibitor gene
RefTitle causing type I hereditary angioedema.
RefLoc Hum Genet 98:452-453 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15264
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1141
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 361
Feature /change: Q -> X
Diagnosis HAE Type I
Sex XX
Ethnic origin Mongoloid; Japan
Family history Inherited
Relative SERPING1base; S0083 brother
Relative SERPING1base; S0085 nephew
Relative SERPING1base; S0086 nephew
Relative SERPING1base; S0087 nephew's son
//
ID Q361X(1c); standard; MUTATION;
Accession S0085
Systematic name g.15264C>T, c.1081C>T, r.1081c>u, p.Gln361X
Description A point mutation in the exon 7 leading to a premature stop
Description codon
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8792821
RefAuthors Ono, H., Kawaguchi, H., Ishii, N., Nakajima, H.
RefTitle A point mutation in exon 7 of the C1-inhibitor gene
RefTitle causing type I hereditary angioedema.
RefLoc Hum Genet 98:452-453 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15264
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1141
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 361
Feature /change: Q -> X
Diagnosis HAE Type I
Sex XY
Ethnic origin Mongoloid; Japan
Family history Inherited
Relative SERPING1base; S0083 father
Relative SERPING1base; S0084 aunt
Relative SERPING1base; S0086 brother
Relative SERPING1base; S0087 son
//
ID Q361X(1d); standard; MUTATION;
Accession S0086
Systematic name g.15264C>T, c.1081C>T, r.1081c>u, p.Gln361X
Description A point mutation in the exon 7 leading to a premature stop
Description codon
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8792821
RefAuthors Ono, H., Kawaguchi, H., Ishii, N., Nakajima, H.
RefTitle A point mutation in exon 7 of the C1-inhibitor gene
RefTitle causing type I hereditary angioedema.
RefLoc Hum Genet 98:452-453 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15264
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1141
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 361
Feature /change: Q -> X
Diagnosis HAE Type I
Sex XY
Ethnic origin Mongoloid; Japan
Family history Inherited
Relative SERPING1base; S0083 father
Relative SERPING1base; S0084 aunt
Relative SERPING1base; S0085 brother
Relative SERPING1base; S0087 nephew
//
ID Q361X(1e); standard; MUTATION;
Accession S0087
Systematic name g.15264C>T, c.1081C>T, r.1081c>u, p.Gln361X
Description A point mutation in the exon 7 leading to a premature stop
Description codon
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8792821
RefAuthors Ono, H., Kawaguchi, H., Ishii, N., Nakajima, H.
RefTitle A point mutation in exon 7 of the C1-inhibitor gene
RefTitle causing type I hereditary angioedema.
RefLoc Hum Genet 98:452-453 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15264
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1141
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 361
Feature /change: Q -> X
Diagnosis HAE Type I
Sex XY
Ethnic origin Mongoloid; Japan
Family history Inherited
Relative SERPING1base; S0083 grandfather
Relative SERPING1base; S0084 great-aunt
Relative SERPING1base; S0085 father
Relative SERPING1base; S0086 uncle
//
ID #D369X396(1); standard; MUTATION;
Accession S0165
Systematic name g.15289delA, c.1106delA, r.1106dela, p.Asp369fsX28
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 15289
Feature /change: -a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 1166
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 369
Feature /change: D -> AWNRLSALLF SRPSWRNWRC PSSSPLSX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Hungary
//
ID Q372X(1); standard; MUTATION;
Accession S0238
Systematic name g.15297C>T, c.1114C>T, r.1114c>u, p.Gln372X
Original code N
Description A point mutation in the exon 7 leading to a premature stop
Description codon
Date 25-Aug-2005 (Rel. 1, Created)
Date 25-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15297
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1174
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 372
Feature /change: Q -> X
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID F379S(1); standard; MUTATION;
Accession S0239
Systematic name g.15319T>C, c.1136T>C, r.1136u>c, p.Phe379Ser
Original code AY
Description A point mutation in the exon 7 leading to an amino acid
Description change
Date 25-Aug-2005 (Rel. 1, Created)
Date 25-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15319
Feature /change: t -> c
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1196
Feature /codon: ttc -> tcc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 379
Feature /change: F -> S
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID T394P(1); standard; MUTATION;
Accession S0045
Systematic name g.15363A>C, c.1180A>C, r.1180a>c, p.Thr394Pro
Original code E:18
Description A point mutation in the exon 7 leading to an amino acid
Description change
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15363
Feature /change: a -> c
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1240
Feature /codon: act -> cct; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 394
Feature /change: T -> P
Diagnosis HAE Type I
//
ID T394P(2); standard; MUTATION;
Accession S0152
Systematic name g.15363A>C, c.1180A>C, r.1180a>c, p.Thr394Pro
Description A point mutation in the exon 7 leading to an amino acid
Description change
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15363
Feature /change: a -> c
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1240
Feature /codon: act -> cct; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 394
Feature /change: T -> P
Diagnosis HAE Type I
Ethnic origin Caucasoid; Hungary
//
ID P399L(1); standard; MUTATION;
Accession S0240
Systematic name g.15379C>T, c.1196C>T, r.1196c>u, p.Pro399Leu
Original code AX
Description A point mutation in the exon 7 leading to an amino acid
Description change
Date 25-Aug-2005 (Rel. 1, Created)
Date 25-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15379
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1256
Feature /codon: ccc -> ctc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 399
Feature /change: P -> L
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID P399R(1); standard; MUTATION;
Accession S0241
Systematic name g.15379C>G, c.1196C>G, r.1196c>g, p.Pro399Arg
Original code BG
Description A point mutation in the exon 7 leading to an amino acid
Description change
Date 25-Aug-2005 (Rel. 1, Created)
Date 25-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15379
Feature /change: c -> g
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1256
Feature /codon: ccc -> cgc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 399
Feature /change: P -> R
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID @K402X424(1); standard; MUTATION;
Accession S0242
Systematic name g.15386dupC, c.1203dupC, r.1203dupc, p.Lys402fsX23
Original code AE
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon
Date 25-Aug-2005 (Rel. 1, Created)
Date 25-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0077: 15387
Feature /change: +c
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 1264
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 402
Feature /change: K -> QSDDQPGYAL NHGEIGILRF FLX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID D408V(1); standard; MUTATION;
Accession S0151
Systematic name g.15406A>T, c.1223A>T, r.1223a>u, p.Asp408Val
Description A point mutation in the exon 7 leading to an amino acid
Description change
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15406
Feature /change: a -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1283
Feature /codon: gat -> gtt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 408
Feature /change: D -> V
Diagnosis HAE Type I
Ethnic origin Caucasoid; Hungary
//
ID M409T(1); standard; MUTATION;
Accession S0243
Systematic name g.15409T>C, c.1226T>C, r.1226u>c, p.Met409Thr
Original code O
Description A point mutation in the exon 7 leading to an amino acid
Description change
Date 25-Aug-2005 (Rel. 1, Created)
Date 25-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15409
Feature /change: t -> c
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1286
Feature /codon: atg -> acg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 409
Feature /change: M -> T
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID #M409X430(1); standard; MUTATION;
Accession S0244
Systematic name g.15410delG, c.1227delG, r.1227delg, p.Met409fsX22
Original code DL
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon
Date 25-Aug-2005 (Rel. 1, Created)
Date 25-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 15410
Feature /change: -g
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 1287
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 409
Feature /change: M -> ISQSWRNWNS SIFLMTLTCV GX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID S411X(1); standard; MUTATION;
Accession S0121
Systematic name g.15415C>A, c.1232C>A, r.1232c>a, p.Ser411X
Original code Patient 171
Description A point mutation in the exon 7 leading to a premature stop
Description codon
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11112899
RefAuthors Pappalardo, E., Cicardi, M., Duponchel, C., Carugati, A.,
RefAuthors Choquet, S., Agostoni, A., Tosi, M.
RefTitle Frequent de novo mutations and exon deletions in the
RefTitle C1inhibitor gene of patients with angioedema.
RefLoc J Allergy Clin Immunol 106:1147-1154 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15415
Feature /change: c -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1292
Feature /codon: tca -> taa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 411
Feature /change: S -> X
Diagnosis HAE
//
ID #S422X430(1a); standard; MUTATION;
Accession S0011
Systematic name g.17838delT, c.1264delT, r.1264delu, p.Ser422fsX9
Description A frame shift deletion mutation in the exon 8 leading to a
Description premature stop codon
Date 01-Jun-2004 (Rel. 1, Created)
Date 01-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1885769
RefAuthors Frangi, D., Cicardi, M., Sica, A., Colotta, F., Agostoni,
RefAuthors A., Davis, A. E.
RefTitle Nonsense mutations affect C1 inhibitor messenger RNA
RefTitle levels in patients with type I hereditary angioneurotic
RefTitle edema.
RefLoc J Clin Invest 88:755-759 (1991)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 17838
Feature /change: -t
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 1324
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 422
Feature /change: S -> LMTLTCVGX
Diagnosis HAE Type I
Relative SERPING1base; S0012
//
ID #S422X430(1b); standard; MUTATION;
Accession S0012
Systematic name g.17838delT, c.1264delT, r.1264delu, p.Ser422fsX9
Description A frame shift deletion mutation in the exon 8 leading to a
Description premature stop codon
Date 01-Jun-2004 (Rel. 1, Created)
Date 01-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1885769
RefAuthors Frangi, D., Cicardi, M., Sica, A., Colotta, F., Agostoni,
RefAuthors A., Davis, A. E.
RefTitle Nonsense mutations affect C1 inhibitor messenger RNA
RefTitle levels in patients with type I hereditary angioneurotic
RefTitle edema.
RefLoc J Clin Invest 88:755-759 (1991)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 17838
Feature /change: -t
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 1324
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 422
Feature /change: S -> LMTLTCVGX
Diagnosis HAE Type I
Relative SERPING1base; S0011
//
ID @Y423X(1a); standard; MUTATION;
Accession S0009
Systematic name g.17842dupA, c.1268dupA, r.1268dupa, p.Tyr423X
Description A duplication mutation in the exon 8 leading to a
Description premature stop codon
Date 01-Jun-2004 (Rel. 1, Created)
Date 01-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1885769
RefAuthors Frangi, D., Cicardi, M., Sica, A., Colotta, F., Agostoni,
RefAuthors A., Davis, A. E.
RefTitle Nonsense mutations affect C1 inhibitor messenger RNA
RefTitle levels in patients with type I hereditary angioneurotic
RefTitle edema.
RefLoc J Clin Invest 88:755-759 (1991)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0077: 17843
Feature /change: +a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1329
Feature /codon: tat -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 423
Feature /change: Y -> X
Diagnosis HAE Type I
Relative SERPING1base; S0010
//
ID @Y423X(1b); standard; MUTATION;
Accession S0010
Systematic name g.17842dupA, c.1268dupA, r.1268dupa, p.Tyr423X
Description A duplication mutation in the exon 8 leading to a
Description premature stop codon
Date 01-Jun-2004 (Rel. 1, Created)
Date 01-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1885769
RefAuthors Frangi, D., Cicardi, M., Sica, A., Colotta, F., Agostoni,
RefAuthors A., Davis, A. E.
RefTitle Nonsense mutations affect C1 inhibitor messenger RNA
RefTitle levels in patients with type I hereditary angioneurotic
RefTitle edema.
RefLoc J Clin Invest 88:755-759 (1991)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0077: 17843
Feature /change: +a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1329
Feature /codon: tat -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 423
Feature /change: Y -> X
Diagnosis HAE Type I
Relative SERPING1base; S0009
//
ID #C428X471(1); standard; MUTATION;
Accession S0102
Systematic name g.17858_17859delTG, c.1284_1285delTG, r.1284_1285delug,
Systematic name p.Cys428fsX44
Description A frame shift deletion mutation in the exon 8 leading to a
Description premature stop codon
Date 03-Aug-2004 (Rel. 1, Created)
Date 03-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11933207
RefAuthors Freiberger, T., Kolarova, L., Mejstrik, P., Vyskocilova,
RefAuthors M., Kuklinek, P., Litzman, J.
RefTitle Five novel mutations in the C1 inhibitor gene (C1NH)
RefTitle leading to a premature stop codon in patients with type I
RefTitle hereditary angioedema.
RefLoc Hum Mutat 19:461 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 17858..17859
Feature /change: -tg
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077:
Feature /loc: 1344..1345
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 428..429
Feature /change: CG ->
Feature /change: WADRGPRSSG FCDAAPDSAG TDRDWGGGGC SLRHLCGPHP AGLX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Czech
//
ID #L436X449(1); standard; MUTATION;
Accession S0197
Systematic name g.17880delC, c.1306delC, r.1306delc, p.Leu436fsX14
Description A frame shift deletion mutation in the exon 8 leading to a
Description premature stop codon
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1339401
RefAuthors Siddique, Z., McPhaden, A. R., McCluskey, D., Whaley, K.
RefTitle A single base deletion from the C1-inhibitor gene causes
RefTitle type I hereditary angio-oedema.
RefLoc Hum Hered 42:231-234 (1992)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 17880
Feature /change: -c
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 1366
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 436
Feature /change: L -> FRFLRCSTRQ CWNX
Diagnosis HAE Type I
//
ID #S439X449(1); standard; MUTATION;
Accession S0116
Systematic name g.17890delC, c.1316delC, r.1316delc, p.Ser439fsX11
Original code Patient 121
Description A frame shift deletion mutation in the exon 8 leading to a
Description premature stop codon
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11112899
RefAuthors Pappalardo, E., Cicardi, M., Duponchel, C., Carugati, A.,
RefAuthors Choquet, S., Agostoni, A., Tosi, M.
RefTitle Frequent de novo mutations and exon deletions in the
RefTitle C1inhibitor gene of patients with angioedema.
RefLoc J Allergy Clin Immunol 106:1147-1154 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 17890
Feature /change: -c
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 1376
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 439
Feature /change: S -> LRCSTRQCWN X
Diagnosis HAE
//
ID #S439X449(2); standard; MUTATION;
Accession S0145
Systematic name g.17889delT, c.1315delT, r.1315delu, p.Ser439fsX11
Original code AC
Description A frame shift deletion mutation in the exon 8 leading to a
Description premature stop codon
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 17889
Feature /change: -t
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 1375
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 439
Feature /change: S -> LRCSTRQCWN X
Diagnosis HAE Type I
Family history Inherited
//
ID H443R(1); standard; MUTATION;
Accession S0073
Systematic name g.17902A>G, c.1328A>G, r.1328a>g, p.His443Arg
Original code Kindred 13
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17902
Feature /change: a -> g
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1388
Feature /codon: cac -> cgc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 443
Feature /change: H -> R
Diagnosis HAE Type I
//
ID H443R(2); standard; MUTATION;
Accession S0123
Systematic name g.17902A>G, c.1328A>G, r.1328a>g, p.His443Arg
Original code BW
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17902
Feature /change: a -> g
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1388
Feature /codon: cac -> cgc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 443
Feature /change: H -> R
Diagnosis HAE Type I
Family history De novo
//
ID #E448X471(1); standard; MUTATION;
Accession S0114
Systematic name g.17917_17919delinsT, c.1343_1345delinsT,
Systematic name r.1343_1345delinsu, p.Glu448fsX24
Original code Patient 91
Description A frame shift indel mutation in the exon 8 leading to a
Description premature stop codon
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11112899
RefAuthors Pappalardo, E., Cicardi, M., Duponchel, C., Carugati, A.,
RefAuthors Choquet, S., Agostoni, A., Tosi, M.
RefTitle Frequent de novo mutations and exon deletions in the
RefTitle C1inhibitor gene of patients with angioedema.
RefLoc J Allergy Clin Immunol 106:1147-1154 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0077: 17917..17919
Feature /change: aac -> t
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077:
Feature /loc: 1403..1405
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 448
Feature /change: E -> VDRDWGGGGC SLRHLCGPHP AGLX
Diagnosis HAE
//
ID #E451X471(1); standard; MUTATION;
Accession S0277
Systematic name g.17925_17926delGA, c.1351_1352delGA, r.1351_1352delga,
Systematic name p.Glu451fsX21
Original code 35-year-old woman
Description A frame shift deletion mutation in the exon 8 leading to a
Description premature stop codon
Date 03-Sep-2007 (Rel. 1, Created)
Date 03-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17502473
RefAuthors Yakushiji, Y., Mizuta, H., Kurohara, K., Onoue, H., Okada,
RefAuthors R., Yoshimura, T., Kuroda, Y.
RefTitle Vasculitic neuropathy in a patient with hereditary C1
RefTitle inhibitor deficiency.
RefLoc Arch Neurol:731-733 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 17925..17926
Feature /change: -ga
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 1411..1412
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 451
Feature /change: E -> DWGGGGCSLR HLCGPHPAGL X
Diagnosis Hereditary C1INH deficiency
Symptoms Nonsystemic vasculitic neuropathy, left-sided facial palsy,
Symptoms SLE-like ilness
Sex XX
//
ID @E451X472(1); standard; MUTATION;
Accession S0147
Systematic name g.17924dupA, c.1350dupA, r.1350dupa, p.Glu451fsX22
Original code R
Description A frame shift duplication mutation in the exon 8 leading
Description to a premature stop codon
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0077: 17925
Feature /change: +a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 1411
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 451
Feature /change: E -> RDWGGGGCSL RHLCGPHPAG LX
Diagnosis HAE Type I
Family history Inherited
//
ID @E451X472(2); standard; MUTATION;
Accession S0148
Systematic name g.17924dupA, c.1350dupA, r.1350dupa, p.Glu451fsX22
Original code Y
Description A frame shift duplication mutation in the exon 8 leading
Description to a premature stop codon
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0077: 17925
Feature /change: +a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 1411
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 451
Feature /change: E -> RDWGGGGCSL RHLCGPHPAG LX
Diagnosis HAE Type I
Family history Inherited
//
ID @G453+1(1); standard; MUTATION;
Accession S0016
Systematic name g.17931_17932insTGT, c.1357_1358insTGT, r.1357_1358insugu,
Systematic name p.Thr452_Gly453insValTrp
Original code Mo
Description An inframe insertion in the exon 8 leading to an amino
Description acid change
Date 18-Jun-2004 (Rel. 1, Created)
Date 18-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8396558
RefAuthors Siddique, Z., McPhaden, A. R., Whaley, K.
RefTitle C1-inhibitor gene nucleotide insertion causes type II
RefTitle hereditary angio-oedema.
RefLoc Hum Genet 92:189-190 (1993)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0077: 17932
Feature /change: +tgt
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe insertion
Feature /loc: IDRefSeq: C0077: 1418
Feature aa; 3
Feature /rnalink: 2
Feature /name: insertion; inframe
Feature /loc: UniProt: P05155; IC1_HUMAN: 453
Feature /change: G -> VW
Diagnosis HAE Type II
Sex XY
Ethnic origin Caucasoid
Family history Inherited
//
ID V454E(1); standard; MUTATION;
Accession S0014
Systematic name g.17935T>A, c.1361T>A, r.1361u>a, p.Val454Glu
Original code We
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 18-Jun-2004 (Rel. 1, Created)
Date 18-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1363816
RefAuthors Davis, A. E., Aulak, K., Parad, R. B., Stecklein, H. P.,
RefAuthors Eldering, E., Hack, C. E., Kramer, J., Strunk, R. C.,
RefAuthors Bissler, J., Rosen, F. S.
RefTitle C1 inhibitor hinge region mutations produce dysfunction
RefTitle by different mechanisms.
RefLoc Nat Genet 1:354-358 (1992)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17935
Feature /change: t -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1421
Feature /codon: gtg -> gag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 454
Feature /change: V -> E
Diagnosis HAE Type II
//
ID #V454X535(1); standard; MUTATION;
Accession S0077
Systematic name g.17934_17967del, c.1360_1393del, r.1360_1393del,
Systematic name p.Val454fsX82
Original code Fi
Description A frame shift deletion mutation in the exon 8 leading to a
Description premature stop codon
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8125476
RefAuthors Bissler, J. J., Donaldson, V. H., Davis, A. E.
RefTitle Contiguous deletion and duplication mutations resulting
RefTitle in type 1 hereditary angioneurotic edema.
RefLoc Hum Genet 93:265-269 (1994)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 17934..17967
Feature /change: -gtggaggcgg ctgcagcctc cgccatctct gtgg
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077:
Feature /loc: 1420..1453
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 454..465
Feature /change: VEAAAASAIS VA ->
Feature /change: PAPCWSLKCS SPSSSCSGTS STSSLSSWGE YMTPGPETCR
Feature /change: IRLGRALPLQ PQLSVAALLL PAWTCPCHLL PQVSAIHQKG SX
Diagnosis HAE Type I
Symptoms systemic lupus erythematosus at the age of 25 years
//
ID A456E(1); standard; MUTATION;
Accession S0122
Systematic name g.17941C>A, c.1367C>A, r.1367c>a, p.Ala456Glu
Original code Ma
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2026621
RefAuthors Skriver, K., Wikoff, W. R., Patston, P. A., Tausk, F.,
RefAuthors Schapira, M., Kaplan, A. P., Bock, S. C.
RefTitle Substrate properties of C1 inhibitor ma (alanine 434----
RefTitle glutamic acid). genetic and structural evidence
RefTitle suggesting that the P12-region contains critical
RefTitle serine protease inhibitor/substrate status.
RefLoc J Biol Chem 266:9216-9221 (1991)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17941
Feature /change: c -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1427
Feature /codon: gcg -> gag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 456
Feature /change: A -> E
Diagnosis HAE Type II
Family history Inherited
//
ID A456E(2); standard; MUTATION;
Accession S0124
Systematic name g.17941C>A, c.1367C>A, r.1367c>a, p.Ala456Glu
Original code I
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17941
Feature /change: c -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1427
Feature /codon: gcg -> gag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 456
Feature /change: A -> E
Diagnosis HAE Type II
//
ID A458T(1); standard; MUTATION;
Accession S0006
Systematic name g.17946G>A, c.1372G>A, r.1372g>a, p.Ala458Thr
Original code Family A
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 31-May-2004 (Rel. 1, Created)
Date 31-May-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2296585
RefAuthors Levy, N. J., Ramesh, N., Cicardi, M., Harrison, R. A.,
RefAuthors Davis, A. E.
RefTitle Type II hereditary angioneurotic edema that may result
RefTitle from a single nucleotide change in the codon for alanine-
RefTitle 436 in the C1 inhibitor gene.
RefLoc Proc Natl Acad Sci U S A 87:265-268 (1990)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17946
Feature /change: g -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1432
Feature /codon: gca -> aca; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 458
Feature /change: A -> T
Diagnosis HAE Type II
//
ID A458T(2); standard; MUTATION;
Accession S0007
Systematic name g.17946G>A, c.1372G>A, r.1372g>a, p.Ala458Thr
Original code Family C
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 31-May-2004 (Rel. 1, Created)
Date 31-May-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2296585
RefAuthors Levy, N. J., Ramesh, N., Cicardi, M., Harrison, R. A.,
RefAuthors Davis, A. E.
RefTitle Type II hereditary angioneurotic edema that may result
RefTitle from a single nucleotide change in the codon for alanine-
RefTitle 436 in the C1 inhibitor gene.
RefLoc Proc Natl Acad Sci U S A 87:265-268 (1990)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17946
Feature /change: g -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1432
Feature /codon: gca -> aca; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 458
Feature /change: A -> T
Diagnosis HAE Type II
//
ID A458T(3); standard; MUTATION;
Accession S0015
Systematic name g.17946G>A, c.1372G>A, r.1372g>a, p.Ala458Thr
Original code Mo
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 18-Jun-2004 (Rel. 1, Created)
Date 18-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1363816
RefAuthors Davis, A. E., Aulak, K., Parad, R. B., Stecklein, H. P.,
RefAuthors Eldering, E., Hack, C. E., Kramer, J., Strunk, R. C.,
RefAuthors Bissler, J., Rosen, F. S.
RefTitle C1 inhibitor hinge region mutations produce dysfunction
RefTitle by different mechanisms.
RefLoc Nat Genet 1:354-358 (1992)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17946
Feature /change: g -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1432
Feature /codon: gca -> aca; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 458
Feature /change: A -> T
Diagnosis HAE Type II
//
ID S460P(1); standard; MUTATION;
Accession S0125
Systematic name g.17952T>C, c.1378T>C, r.1378u>c, p.Ser460Pro
Original code DI
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17952
Feature /change: t -> c
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1438
Feature /codon: tcc -> ccc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 460
Feature /change: S -> P
Diagnosis HAE Type II
//
ID @A461X555(1); standard; MUTATION;
Accession S0166
Systematic name g.17931_17956dup, c.1357_1382dup, r.1357_1382dup,
Systematic name p.Ile462fsX94
Description A frame shift duplication mutation in the exon 8 leading
Description to elongation of the protein
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0077: 17957
Feature /change: +ggggtggagg cggctgcagc ctccgc
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 1443
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; elongation
Feature /loc: UniProt: P05155; IC1_HUMAN: 461
Feature /change: A ->
Feature /change: AGWRRLQPPP SLWPAPCWSL KCSSPSSSCS GTSSTSSLSS
Feature /change: WGEYMTPGPE TCRIRLGRAL PLQPQLSVAA LLLPAWTCPC
Feature /change: HLLPQVSAIH QKGSX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Hungary
//
ID I462S(1a),I462S(1a); standard; MUTATION;
Accession S0263
Systematic name Allele 1 and 2: g.17959T>G, c.1385T>G, r.1385u>g,
Systematic name p.Ile462Ser
Original code Patient IV.2
Description Allele 1 and 2: A point mutation in the exon 8 leading to
Description an amino acid change
Date 04-May-2007 (Rel. 1, Created)
Date 04-May-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17137866
RefAuthors Blanch, A., Roche, O., Urrutia, I., Gamboa, P., Fontan,
RefAuthors G., Lopez-Trascasa, M.
RefTitle First case of homozygous C1 inhibitor deficiency.
RefLoc J Allergy Clin Immunol:1330-1335 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17959
Feature /change: t -> g
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1445
Feature /codon: atc -> agc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 462
Feature /change: I -> S
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17959
Feature /change: t -> g
Feature /genomic_region: exon; 8
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1445
Feature /codon: atc -> agc; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 462
Feature /change: I -> S
Diagnosis HAE Type I
Protein exp. Undetectable C1q levels, reduced C1s levels, and the
Protein exp. circulating active C1r form
Symptoms One angioedema attact per year affecting his face
Age 21
Sex XY
Family history Inherited
Relative SERPING1base; S0264 sister
//
ID I462S(1b),I462S(1b); standard; MUTATION;
Accession S0264
Systematic name Allele 1 and 2: g.17959T>G, c.1385T>G, r.1385u>g,
Systematic name p.Ile462Ser
Original code Patient IV.3
Description Allele 1 and 2: A point mutation in the exon 8 leading to
Description an amino acid change
Date 04-May-2007 (Rel. 1, Created)
Date 04-May-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17137866
RefAuthors Blanch, A., Roche, O., Urrutia, I., Gamboa, P., Fontan,
RefAuthors G., Lopez-Trascasa, M.
RefTitle First case of homozygous C1 inhibitor deficiency.
RefLoc J Allergy Clin Immunol:1330-1335 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17959
Feature /change: t -> g
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1445
Feature /codon: atc -> agc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 462
Feature /change: I -> S
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17959
Feature /change: t -> g
Feature /genomic_region: exon; 8
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1445
Feature /codon: atc -> agc; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 462
Feature /change: I -> S
Diagnosis HAE Type I
Protein exp. Undetectable C1q levels, reduced C1s levels, and the
Protein exp. circulating active C1r form
Symptoms Currently asymptomatic
Sex XX
Family history Inherited
Relative SERPING1base; S0263 brother
//
ID @I462X472(1); standard; MUTATION;
Accession S0146
Systematic name g.17957dupC, c.1383dupC, r.1383dupc, p.Ile462fsX11
Original code AÑ
Description A frame shift duplication mutation in the exon 8 leading
Description to a premature stop codon
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0077: 17958
Feature /change: +c
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 1444
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 462
Feature /change: I -> HLCGPHPAGL X
Diagnosis HAE Type I
Family history Inherited
//
ID R466C(1a); standard; MUTATION;
Accession S0001
Systematic name g.17970C>T, c.1396C>T, r.1396c>u, p.Arg466Cys
Original code Da-I-1
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 18-May-2004 (Rel. 1, Created)
Date 18-May-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2563376
RefAuthors Skriver, K., Radziejewska, E., Silbermann, J. A.,
RefAuthors Donaldson, V. H., Bock, S. C.
RefTitle CpG mutations in the reactive site of human C1 inhibitor.
RefLoc J Biol Chem 264:3066-3071 (1989)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17970
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1456
Feature /codon: cgc -> tgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> C
Diagnosis HAE
Sex XY
Relative SERPING1base; S0002 daughter
//
ID R466C(1b); standard; MUTATION;
Accession S0002
Systematic name g.17970C>T, c.1396C>T, r.1396c>u, p.Arg466Cys
Original code Da-II-2
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 18-May-2004 (Rel. 1, Created)
Date 18-May-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2563376
RefAuthors Skriver, K., Radziejewska, E., Silbermann, J. A.,
RefAuthors Donaldson, V. H., Bock, S. C.
RefTitle CpG mutations in the reactive site of human C1 inhibitor.
RefLoc J Biol Chem 264:3066-3071 (1989)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17970
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1456
Feature /codon: cgc -> tgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> C
Diagnosis HAE
Sex XX
Relative SERPING1base; S0001 father
//
ID R466C(2); standard; MUTATION;
Accession S0103
Systematic name g.17970C>T, c.1396C>T, r.1396c>u, p.Arg466Cys
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 03-Aug-2004 (Rel. 1, Created)
Date 03-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11933207
RefAuthors Freiberger, T., Kolarova, L., Mejstrik, P., Vyskocilova,
RefAuthors M., Kuklinek, P., Litzman, J.
RefTitle Five novel mutations in the C1 inhibitor gene (C1NH)
RefTitle leading to a premature stop codon in patients with type I
RefTitle hereditary angioedema.
RefLoc Hum Mutat 19:461 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17970
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1456
Feature /codon: cgc -> tgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> C
Diagnosis HAE Type II
Ethnic origin Caucasoid; Czech
Family history Inherited
//
ID R466C(3); standard; MUTATION;
Accession S0104
Systematic name g.17970C>T, c.1396C>T, r.1396c>u, p.Arg466Cys
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 03-Aug-2004 (Rel. 1, Created)
Date 03-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11933207
RefAuthors Freiberger, T., Kolarova, L., Mejstrik, P., Vyskocilova,
RefAuthors M., Kuklinek, P., Litzman, J.
RefTitle Five novel mutations in the C1 inhibitor gene (C1NH)
RefTitle leading to a premature stop codon in patients with type I
RefTitle hereditary angioedema.
RefLoc Hum Mutat 19:461 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17970
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1456
Feature /codon: cgc -> tgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> C
Diagnosis HAE Type II
Ethnic origin Caucasoid; Czech
Family history Inherited
//
ID R466C(4); standard; MUTATION;
Accession S0118
Systematic name g.17970C>T, c.1396C>T, r.1396c>u, p.Arg466Cys
Original code Patient 141
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11112899
RefAuthors Pappalardo, E., Cicardi, M., Duponchel, C., Carugati, A.,
RefAuthors Choquet, S., Agostoni, A., Tosi, M.
RefTitle Frequent de novo mutations and exon deletions in the
RefTitle C1inhibitor gene of patients with angioedema.
RefLoc J Allergy Clin Immunol 106:1147-1154 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17970
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1456
Feature /codon: cgc -> tgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> C
Diagnosis HAE Type II
//
ID R466C(5); standard; MUTATION;
Accession S0126
Systematic name g.17970C>T, c.1396C>T, r.1396c>u, p.Arg466Cys
Original code AA
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17970
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1456
Feature /codon: cgc -> tgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> C
Diagnosis HAE Type II
Family history Inherited
//
ID R466C(6); standard; MUTATION;
Accession S0127
Systematic name g.17970C>T, c.1396C>T, r.1396c>u, p.Arg466Cys
Original code AW
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17970
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1456
Feature /codon: cgc -> tgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> C
Diagnosis HAE Type II
Family history De novo
//
ID R466C(7); standard; MUTATION;
Accession S0128
Systematic name g.17970C>T, c.1396C>T, r.1396c>u, p.Arg466Cys
Original code BR
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17970
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1456
Feature /codon: cgc -> tgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> C
Diagnosis HAE Type II
Family history Inherited
//
ID R466C(8); standard; MUTATION;
Accession S0129
Systematic name g.17970C>T, c.1396C>T, r.1396c>u, p.Arg466Cys
Original code DT
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17970
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1456
Feature /codon: cgc -> tgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> C
Diagnosis HAE Type II
Family history Inherited
//
ID R466C(9); standard; MUTATION;
Accession S0153
Systematic name g.17970C>T, c.1396C>T, r.1396c>u, p.Arg466Cys
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17970
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1456
Feature /codon: cgc -> tgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> C
Diagnosis HAE Type II
Ethnic origin Caucasoid; Hungary
//
ID R466C(10); standard; MUTATION;
Accession S0154
Systematic name g.17970C>T, c.1396C>T, r.1396c>u, p.Arg466Cys
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17970
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1456
Feature /codon: cgc -> tgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> C
Diagnosis HAE Type II
Ethnic origin Caucasoid; Hungary
//
ID R466C(11); standard; MUTATION;
Accession S0155
Systematic name g.17970C>T, c.1396C>T, r.1396c>u, p.Arg466Cys
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17970
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1456
Feature /codon: cgc -> tgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> C
Diagnosis HAE Type II
Ethnic origin Caucasoid; Hungary
//
ID R466C(12a); standard; MUTATION;
Accession S0265
Systematic name g.17970C>T, c.1396C>T, r.1396c>u, p.Arg466Cys
Original code S.O.H.
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 22-May-2007 (Rel. 1, Created)
Date 22-May-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17219074
RefAuthors Williams, Y., Byrne, G., Lynch, S., Feighery, C.,
RefAuthors Abuzakouk, M.
RefTitle Type II hereditary angioedema: presenting as food allergy.
RefLoc Dig Dis Sci:353-356 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17970
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1456
Feature /codon: cgc -> tgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> C
Diagnosis HAE Type II
Protein exp. reduced functional C1INH activity
Sex XX
Family history Inherited
Relative SERPING1base; S0266 father
Relative SERPING1base; S0267 brother
//
ID R466C(12b); standard; MUTATION;
Accession S0266
Systematic name g.17970C>T, c.1396C>T, r.1396c>u, p.Arg466Cys
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 22-May-2007 (Rel. 1, Created)
Date 22-May-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17219074
RefAuthors Williams, Y., Byrne, G., Lynch, S., Feighery, C.,
RefAuthors Abuzakouk, M.
RefTitle Type II hereditary angioedema: presenting as food allergy.
RefLoc Dig Dis Sci:353-356 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17970
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1456
Feature /codon: cgc -> tgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> C
Diagnosis HAE Type II
Protein exp. reduced functional C1INH activity
Sex XY
Family history Inherited
Relative SERPING1base; S0265 daughter
Relative SERPING1base; S0267 brother
Comment The patient also has heterozygous polymorphism 18012G>A
Comment (V480M)
//
ID R466C(12c); standard; MUTATION;
Accession S0267
Systematic name g.17970C>T, c.1396C>T, r.1396c>u, p.Arg466Cys
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 22-May-2007 (Rel. 1, Created)
Date 22-May-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17219074
RefAuthors Williams, Y., Byrne, G., Lynch, S., Feighery, C.,
RefAuthors Abuzakouk, M.
RefTitle Type II hereditary angioedema: presenting as food allergy.
RefLoc Dig Dis Sci:353-356 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17970
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1456
Feature /codon: cgc -> tgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> C
Diagnosis HAE Type II
Protein exp. reduced functional C1INH activity
Sex XY
Family history Inherited
Relative SERPING1base; S0265 daughter
Relative SERPING1base; S0266 father
Comment The patient also has heterozygous polymorphism 18012G>A
Comment (V480M)
//
ID R466H(1a); standard; MUTATION;
Accession S0003
Systematic name g.17971G>A, c.1397G>A, r.1397g>a, p.Arg466His
Original code Ri-I-1
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 18-May-2004 (Rel. 1, Created)
Date 18-May-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2563376
RefAuthors Skriver, K., Radziejewska, E., Silbermann, J. A.,
RefAuthors Donaldson, V. H., Bock, S. C.
RefTitle CpG mutations in the reactive site of human C1 inhibitor.
RefLoc J Biol Chem 264:3066-3071 (1989)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17971
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1457
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> H
Diagnosis HAE
Sex XY
Relative SERPING1base; S0004 son
//
ID R466H(1b); standard; MUTATION;
Accession S0004
Systematic name g.17971G>A, c.1397G>A, r.1397g>a, p.Arg466His
Original code Ri-II-1
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 18-May-2004 (Rel. 1, Created)
Date 18-May-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2563376
RefAuthors Skriver, K., Radziejewska, E., Silbermann, J. A.,
RefAuthors Donaldson, V. H., Bock, S. C.
RefTitle CpG mutations in the reactive site of human C1 inhibitor.
RefLoc J Biol Chem 264:3066-3071 (1989)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17971
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1457
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> H
Diagnosis HAE
Sex XY
Relative SERPING1base; S0003 father
//
ID R466H(2); standard; MUTATION;
Accession S0074
Systematic name g.17971G>A, c.1397G>A, r.1397g>a, p.Arg466His
Original code Kindred 14
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17971
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1457
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> H
Diagnosis HAE Type II
//
ID R466H(3); standard; MUTATION;
Accession S0105
Systematic name g.17971G>A, c.1397G>A, r.1397g>a, p.Arg466His
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 03-Aug-2004 (Rel. 1, Created)
Date 03-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11933207
RefAuthors Freiberger, T., Kolarova, L., Mejstrik, P., Vyskocilova,
RefAuthors M., Kuklinek, P., Litzman, J.
RefTitle Five novel mutations in the C1 inhibitor gene (C1NH)
RefTitle leading to a premature stop codon in patients with type I
RefTitle hereditary angioedema.
RefLoc Hum Mutat 19:461 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17971
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1457
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> H
Diagnosis HAE Type II
Ethnic origin Caucasoid; Czech
Family history Inherited
//
ID R466H(4); standard; MUTATION;
Accession S0106
Systematic name g.17971G>A, c.1397G>A, r.1397g>a, p.Arg466His
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 03-Aug-2004 (Rel. 1, Created)
Date 03-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11933207
RefAuthors Freiberger, T., Kolarova, L., Mejstrik, P., Vyskocilova,
RefAuthors M., Kuklinek, P., Litzman, J.
RefTitle Five novel mutations in the C1 inhibitor gene (C1NH)
RefTitle leading to a premature stop codon in patients with type I
RefTitle hereditary angioedema.
RefLoc Hum Mutat 19:461 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17971
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1457
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> H
Diagnosis HAE Type II
Ethnic origin Caucasoid; Czech
Family history Inherited
//
ID R466H(5); standard; MUTATION;
Accession S0130
Systematic name g.17971G>A, c.1397G>A, r.1397g>a, p.Arg466His
Original code BS
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17971
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1457
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> H
Diagnosis HAE Type II
Family history De novo
//
ID R466H(6); standard; MUTATION;
Accession S0131
Systematic name g.17971G>A, c.1397G>A, r.1397g>a, p.Arg466His
Original code DK
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17971
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1457
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> H
Diagnosis HAE Type II
Family history De novo
//
ID R466H(7a); standard; MUTATION;
Accession S0171
Systematic name g.17971G>A, c.1397G>A, r.1397g>a, p.Arg466His
Original code R-1
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14569137
RefAuthors Cumming, S. A., Halsall, D. J., Ewan, P. W., Lomas, D. A.
RefTitle The effect of sequence variations within the coding
RefTitle region of the C1 inhibitor gene on disease expression and
RefTitle protein function in families with hereditary angio-oedema.
RefLoc J Med Genet 40:e114 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17971
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1457
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> H
Diagnosis HAE Type II
Sex XX
Relative SERPING1base; S0172 father
//
ID R466H(7b); standard; MUTATION;
Accession S0172
Systematic name g.17971G>A, c.1397G>A, r.1397g>a, p.Arg466His
Original code R-2
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14569137
RefAuthors Cumming, S. A., Halsall, D. J., Ewan, P. W., Lomas, D. A.
RefTitle The effect of sequence variations within the coding
RefTitle region of the C1 inhibitor gene on disease expression and
RefTitle protein function in families with hereditary angio-oedema.
RefLoc J Med Genet 40:e114 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17971
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1457
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> H
Diagnosis HAE Type II
Sex XY
Relative SERPING1base; S0171 daughter
//
ID R466H(8); standard; MUTATION;
Accession S0195
Systematic name g.17971G>A, c.1397G>A, r.1397g>a, p.Arg466His
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 23-Aug-2005 (Rel. 1, Created)
Date 23-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2894352
RefAuthors McAdam, R. A., Goundis, D., Reid, K. B.
RefTitle A homozygous point mutation results in a stop codon in the
RefTitle C1q B-chain of a C1q-deficient individual.
RefLoc Immunogenetics 27:259-264 (1988)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17971
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1457
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> H
Diagnosis HAE Type II
//
ID R466L(1); standard; MUTATION;
Accession S0075
Systematic name g.17971G>T, c.1397G>T, r.1397g>u, p.Arg466Leu
Original code Kindred 15
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17971
Feature /change: g -> t
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1457
Feature /codon: cgc -> ctc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> L
Diagnosis HAE Type II
//
ID R466L(2); standard; MUTATION;
Accession S0089
Systematic name g.17971G>T, c.1397G>T, r.1397g>u, p.Arg466Leu
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 03-Aug-2004 (Rel. 1, Created)
Date 03-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1451784
RefAuthors Frangi, D., Aulak, K. S., Cicardi, M., Harrison, R. A.,
RefAuthors Davis, A. E.
RefTitle A dysfunctional C1 inhibitor protein with a new reactive
RefTitle center mutation (arg-444-->leu).
RefLoc FEBS Lett 301:34-36 (1992)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17971
Feature /change: g -> t
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1457
Feature /codon: cgc -> ctc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> L
Diagnosis HAE Type II
Sex XX
Family history De novo
//
ID R466L(3); standard; MUTATION;
Accession S0112
Systematic name g.17971G>T, c.1397G>T, r.1397g>u, p.Arg466Leu
Original code Patient 71
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11112899
RefAuthors Pappalardo, E., Cicardi, M., Duponchel, C., Carugati, A.,
RefAuthors Choquet, S., Agostoni, A., Tosi, M.
RefTitle Frequent de novo mutations and exon deletions in the
RefTitle C1inhibitor gene of patients with angioedema.
RefLoc J Allergy Clin Immunol 106:1147-1154 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17971
Feature /change: g -> t
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1457
Feature /codon: cgc -> ctc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> L
Diagnosis HAE
//
ID R466L(4); standard; MUTATION;
Accession S0132
Systematic name g.17971G>T, c.1397G>T, r.1397g>u, p.Arg466Leu
Original code AQ
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17971
Feature /change: g -> t
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1457
Feature /codon: cgc -> ctc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> L
Diagnosis HAE
Family history Inherited
//
ID R466P(1); standard; MUTATION;
Accession S0133
Systematic name g.17971G>C, c.1397G>C, r.1397g>c, p.Arg466Pro
Original code BD
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17971
Feature /change: g -> c
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1457
Feature /codon: cgc -> ccc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> P
Diagnosis HAE Type II
Family history Inherited
//
ID R466S(1); standard; MUTATION;
Accession S0008
Systematic name g.17970C>A, c.1396C>A, r.1396c>a, p.Arg466Ser
Original code Ba
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 01-Jun-2004 (Rel. 1, Created)
Date 01-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2365061
RefAuthors Aulak, K. S., Cicardi, M., Harrison, R. A.
RefTitle Identification of a new P1 residue mutation (444Arg----
RefTitle ser) in a dysfunctional C1 inhibitor protein contained in
RefTitle a type II hereditary angioedema plasma.
RefLoc FEBS Lett 266:13-16 (1990)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17970
Feature /change: c -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1456
Feature /codon: cgc -> agc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 466
Feature /change: R -> S
Diagnosis HAE Type II
//
ID T467P(1a); standard; MUTATION;
Accession S0179
Systematic name g.17973A>C, c.1399A>C, r.1399a>c, p.Thr467Pro
Original code I-2
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 27-Aug-2004 (Rel. 1, Created)
Date 27-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8529136
RefAuthors Ocejo-Vinyals, J. G., Leyva-Cobian, F., Fernandez-Luna,
RefAuthors J. L.
RefTitle A mutation unique in serine protease inhibitors (serpins)
RefTitle identified in a family with type II hereditary
RefTitle angioneurotic edema.
RefLoc Mol Med 1:700-705 (1995)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17973
Feature /change: a -> c
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1459
Feature /codon: acc -> ccc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 467
Feature /change: T -> P
Diagnosis HAE Type II
Protein exp. Levels of the C1 inhibitor: antigenic levels 39 mg/dl,
Protein exp. functional levels 8%, C4 levels 6.4 mg/dl
Sex XY
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative SERPING1base; S0180 daughter
Relative SERPING1base; S0181 daughter
Relative SERPING1base; S0182 grandson
Relative SERPING1base; S0183 granddaughter
//
ID T467P(1b); standard; MUTATION;
Accession S0180
Systematic name g.17973A>C, c.1399A>C, r.1399a>c, p.Thr467Pro
Original code II-2
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 27-Aug-2004 (Rel. 1, Created)
Date 27-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8529136
RefAuthors Ocejo-Vinyals, J. G., Leyva-Cobian, F., Fernandez-Luna,
RefAuthors J. L.
RefTitle A mutation unique in serine protease inhibitors (serpins)
RefTitle identified in a family with type II hereditary
RefTitle angioneurotic edema.
RefLoc Mol Med 1:700-705 (1995)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17973
Feature /change: a -> c
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1459
Feature /codon: acc -> ccc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 467
Feature /change: T -> P
Diagnosis HAE Type II
Protein exp. Levels of the C1 inhibitor: antigenic levels 28 mg/dl,
Protein exp. functional levels 9%, C4 levels 9.6 mg/dl
Sex XX
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative SERPING1base; S0179 father
Relative SERPING1base; S0181 sister
Relative SERPING1base; S0182 son
Relative SERPING1base; S0183 niece
//
ID T467P(1c); standard; MUTATION;
Accession S0181
Systematic name g.17973A>C, c.1399A>C, r.1399a>c, p.Thr467Pro
Original code II-3
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 27-Aug-2004 (Rel. 1, Created)
Date 27-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8529136
RefAuthors Ocejo-Vinyals, J. G., Leyva-Cobian, F., Fernandez-Luna,
RefAuthors J. L.
RefTitle A mutation unique in serine protease inhibitors (serpins)
RefTitle identified in a family with type II hereditary
RefTitle angioneurotic edema.
RefLoc Mol Med 1:700-705 (1995)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17973
Feature /change: a -> c
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1459
Feature /codon: acc -> ccc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 467
Feature /change: T -> P
Diagnosis HAE Type II
Protein exp. Levels of the C1 inhibitor: antigenic levels 17.8 mg/dl,
Protein exp. functional levels 15%, C4 levels 7.2 mg/dl
Sex XX
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative SERPING1base; S0179 father
Relative SERPING1base; S0180 sister
Relative SERPING1base; S0182 nephew
Relative SERPING1base; S0183 daughter
//
ID T467P(1d); standard; MUTATION;
Accession S0182
Systematic name g.17973A>C, c.1399A>C, r.1399a>c, p.Thr467Pro
Original code III-1
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 27-Aug-2004 (Rel. 1, Created)
Date 27-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8529136
RefAuthors Ocejo-Vinyals, J. G., Leyva-Cobian, F., Fernandez-Luna,
RefAuthors J. L.
RefTitle A mutation unique in serine protease inhibitors (serpins)
RefTitle identified in a family with type II hereditary
RefTitle angioneurotic edema.
RefLoc Mol Med 1:700-705 (1995)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17973
Feature /change: a -> c
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1459
Feature /codon: acc -> ccc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 467
Feature /change: T -> P
Diagnosis HAE Type II
Protein exp. Levels of the C1 inhibitor: antigenic levels 24 mg/dl,
Protein exp. functional levels 10%, C4 levels 7.3 mg/dl
Sex XY
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative SERPING1base; S0179 grandfather
Relative SERPING1base; S0180 mother
Relative SERPING1base; S0181 aunt
Relative SERPING1base; S0183 cousin
//
ID T467P(1f); standard; MUTATION;
Accession S0183
Systematic name g.17973A>C, c.1399A>C, r.1399a>c, p.Thr467Pro
Original code III-3
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 27-Aug-2004 (Rel. 1, Created)
Date 27-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8529136
RefAuthors Ocejo-Vinyals, J. G., Leyva-Cobian, F., Fernandez-Luna,
RefAuthors J. L.
RefTitle A mutation unique in serine protease inhibitors (serpins)
RefTitle identified in a family with type II hereditary
RefTitle angioneurotic edema.
RefLoc Mol Med 1:700-705 (1995)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17973
Feature /change: a -> c
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1459
Feature /codon: acc -> ccc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 467
Feature /change: T -> P
Diagnosis HAE Type II
Protein exp. Levels of the C1 inhibitor: antigenic levels 18.3 mg/dl,
Protein exp. functional levels 3%, C4 levels 2.8 mg/dl
Sex XX
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative SERPING1base; S0179 grandfather
Relative SERPING1base; S0180 aunt
Relative SERPING1base; S0181 mother
Relative SERPING1base; S0182 cousin
//
ID @T467X553(1); standard; MUTATION;
Accession S0078
Systematic name g.17953_17972dup, c.1379_1398dup, r.1379_1398dup,
Systematic name p.Thr467fsX87
Original code Ot
Description A frame shift duplication mutation in the exon 8 leading
Description to a premature stop codon
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8125476
RefAuthors Bissler, J. J., Donaldson, V. H., Davis, A. E.
RefTitle Contiguous deletion and duplication mutations resulting
RefTitle in type 1 hereditary angioneurotic edema.
RefLoc Hum Genet 93:265-269 (1994)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0077: 17973
Feature /change: +ccgccatctc tgtggcccgc
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0077: 1459
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 467
Feature /change: T ->
Feature /change: PPSLWPAPCW SLKCSSPSSS CSGTSSTSSL SSWGEYMTPG
Feature /change: PETCRIRLGR ALPLQPQLSV AALLLPAWTC PCHLLPQVSA
Feature /change: IHQKGSX
Diagnosis HAE Type I
//
ID V473E(1); standard; MUTATION;
Accession S0156
Systematic name g.17992T>A, c.1418T>A, r.1418u>a, p.Val473Glu
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17992
Feature /change: t -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1478
Feature /codon: gtg -> gag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 473
Feature /change: V -> E
Diagnosis HAE Type II
Ethnic origin Caucasoid; Hungary
Family history De novo
//
ID V473G(1); standard; MUTATION;
Accession S0134
Systematic name g.17992T>G, c.1418T>G, r.1418u>g, p.Val473Gly
Original code LL
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17992
Feature /change: t -> g
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1478
Feature /codon: gtg -> ggg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 473
Feature /change: V -> G
Diagnosis HAE Type I
Family history Inherited
//
ID V473M(1); standard; MUTATION;
Accession S0017
Systematic name g.17991G>A, c.1417G>A, r.1417g>a, p.Val473Met
Original code F:10
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 28-Jul-2004 (Rel. 1, Created)
Date 28-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
RefNumber [2]
RefCrossRef PUBMED; 7814636
RefAuthors Verpy, E., Couture-Tosi, E., Eldering, E., Lopez-
RefAuthors Trascasa, M., Spath, P., Meo, T., Tosi, M.
RefTitle Crucial residues in the carboxy-terminal end of C1
RefTitle inhibitor revealed by pathogenic mutants impaired in
RefTitle secretion or function.
RefLoc J Clin Invest 95:350-359 (1995)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17991
Feature /change: g -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1477
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 473
Feature /change: V -> M
Diagnosis HAE Type I
//
ID Q474E/L481R(1); standard; MUTATION;
Accession S0018
Systematic name g.17994C>G; g.18016T>G, c.1420C>G; c.1442T>G, r.1420c>g;
Systematic name r.1442u>g, p.Gln474Glu; p.Leu481Arg
Original code F:40
Description A double point mutation in the exon 8 leading to amino
Description acid changes
Date 28-Jul-2004 (Rel. 1, Created)
Date 28-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
RefNumber [2]
RefCrossRef PUBMED; 7814636
RefAuthors Verpy, E., Couture-Tosi, E., Eldering, E., Lopez-
RefAuthors Trascasa, M., Spath, P., Meo, T., Tosi, M.
RefTitle Crucial residues in the carboxy-terminal end of C1
RefTitle inhibitor revealed by pathogenic mutants impaired in
RefTitle secretion or function.
RefLoc J Clin Invest 95:350-359 (1995)
Feature dna; 1
Feature /rnalink: 3
Feature /name: point
Feature /loc: IDRefSeq: D0077: 17994
Feature /change: c -> g
Feature /genomic_region: exon; 8
Feature dna; 2
Feature /rnalink: 4
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18016
Feature /change: t -> g
Feature /genomic_region: exon; 8
Feature rna; 3
Feature /dnalink: 1
Feature /aalink: 5
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1480
Feature /codon: cag -> gag; 1
Feature rna; 4
Feature /dnalink: 2
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1502
Feature /codon: ctc -> cgc; 2
Feature aa; 5
Feature /rnalink: 3
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 474
Feature /change: Q -> E
Feature aa; 6
Feature /rnalink: 4
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 481
Feature /change: L -> R
Diagnosis HAE Type I
//
ID F477S(1); standard; MUTATION;
Accession S0019
Systematic name g.18004T>C, c.1430T>C, r.1430u>c, p.Phe477Ser
Original code F:34
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
RefNumber [2]
RefCrossRef PUBMED; 7814636
RefAuthors Verpy, E., Couture-Tosi, E., Eldering, E., Lopez-
RefAuthors Trascasa, M., Spath, P., Meo, T., Tosi, M.
RefTitle Crucial residues in the carboxy-terminal end of C1
RefTitle inhibitor revealed by pathogenic mutants impaired in
RefTitle secretion or function.
RefLoc J Clin Invest 95:350-359 (1995)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18004
Feature /change: t -> c
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1490
Feature /codon: ttc -> tcc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 477
Feature /change: F -> S
Diagnosis HAE
//
ID F479L(1); standard; MUTATION;
Accession S0094
Systematic name g.18009T>C, c.1435T>C, r.1435u>c, p.Phe479Leu
Original code P5
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 03-Aug-2004 (Rel. 1, Created)
Date 03-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11161971
RefAuthors Bowen, B., Hawk, J. J., Sibunka, S., Hovick, S., Weiler,
RefAuthors J. M.
RefTitle A review of the reported defects in the human C1 esterase
RefTitle inhibitor gene producing hereditary angioedema including
RefTitle four new mutations.
RefLoc Clin Immunol 98:157-163 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18009
Feature /change: t -> c
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1495
Feature /codon: ttc -> ctc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 479
Feature /change: F -> L
Diagnosis HAE Type I
Family history De novo
//
ID L481P(1); standard; MUTATION;
Accession S0020
Systematic name g.18016T>C, c.1442T>C, r.1442u>c, p.Leu481Pro
Original code F:19
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
RefNumber [2]
RefCrossRef PUBMED; 7814636
RefAuthors Verpy, E., Couture-Tosi, E., Eldering, E., Lopez-
RefAuthors Trascasa, M., Spath, P., Meo, T., Tosi, M.
RefTitle Crucial residues in the carboxy-terminal end of C1
RefTitle inhibitor revealed by pathogenic mutants impaired in
RefTitle secretion or function.
RefLoc J Clin Invest 95:350-359 (1995)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18016
Feature /change: t -> c
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1502
Feature /codon: ctc -> ccc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 481
Feature /change: L -> P
Diagnosis HAE
//
ID W482X(1); standard; MUTATION;
Accession S0135
Systematic name g.18020G>A, c.1446G>A, r.1446g>a, p.Trp482X
Original code DS
Description A point mutation in the exon 8 leading to a premature stop
Description codon
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18020
Feature /change: g -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1506
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 482
Feature /change: W -> X
Diagnosis HAE Type I
Family history Inherited
//
ID W482X(2a); standard; MUTATION;
Accession S0284
Systematic name g.18019G>A, c.1445G>A, r.1445g>a, p.Trp482X
Original code B.1
Description A point mutation in the exon 8 leading to a premature stop
Description codon
Date 26-Jul-2010 (Rel. 1, Created)
Date 26-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 19706314
RefAuthors Speletas, M., Boukas, K., Papadopoulou-Alataki, E.,
RefAuthors Tsitsami, E., Germenis, A. E.
RefTitle Hereditary angioedema in greek families caused by novel
RefTitle and recurrent mutations.
RefLoc Hum Immunol:925-929 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18019
Feature /change: g -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077; GI:4557378; SERPING1C: 1505
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 482
Feature /change: W -> X
Diagnosis HAE
Age 76
Sex XX
Ethnic origin Greece
Relative SERPING1base; S0285 son
Relative SERPING1base; S0286 grand-daughter
//
ID W482X(2b); standard; MUTATION;
Accession S0285
Systematic name g.18019G>A, c.1445G>A, r.1445g>a, p.Trp482X
Original code B.2
Description A point mutation in the exon 8 leading to a premature stop
Description codon
Date 26-Jul-2010 (Rel. 1, Created)
Date 26-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 19706314
RefAuthors Speletas, M., Boukas, K., Papadopoulou-Alataki, E.,
RefAuthors Tsitsami, E., Germenis, A. E.
RefTitle Hereditary angioedema in greek families caused by novel
RefTitle and recurrent mutations.
RefLoc Hum Immunol:925-929 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18019
Feature /change: g -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077; GI:4557378; SERPING1C: 1505
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 482
Feature /change: W -> X
Diagnosis HAE
Age 58
Sex XY
Ethnic origin Greece
Relative SERPING1base; S0284 mother
Relative SERPING1base; S0286 daughter
//
ID W482X(2c); standard; MUTATION;
Accession S0286
Systematic name g.18019G>A, c.1445G>A, r.1445g>a, p.Trp482X
Original code B.3
Description A point mutation in the exon 8 leading to a premature stop
Description codon
Date 26-Jul-2010 (Rel. 1, Created)
Date 26-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 19706314
RefAuthors Speletas, M., Boukas, K., Papadopoulou-Alataki, E.,
RefAuthors Tsitsami, E., Germenis, A. E.
RefTitle Hereditary angioedema in greek families caused by novel
RefTitle and recurrent mutations.
RefLoc Hum Immunol:925-929 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18019
Feature /change: g -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077; GI:4557378; SERPING1C: 1505
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 482
Feature /change: W -> X
Diagnosis HAE
Age 30
Sex XX
Ethnic origin Greece
Relative SERPING1base; S0284 grand-mother
Relative SERPING1base; S0285 father
//
ID Q484X(1); standard; MUTATION;
Accession S0136
Systematic name g.18024C>T, c.1450C>T, r.1450c>u, p.Gln484X
Original code Z
Description A point mutation in the exon 8 leading to a premature stop
Description codon
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18024
Feature /change: c -> t
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1510
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 484
Feature /change: Q -> X
Diagnosis HAE Type I
Family history Inherited
//
ID P489R(1); standard; MUTATION;
Accession S0021
Systematic name g.18040C>G, c.1466C>G, r.1466c>g, p.Pro489Arg
Original code F:33
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
RefNumber [2]
RefCrossRef PUBMED; 7814636
RefAuthors Verpy, E., Couture-Tosi, E., Eldering, E., Lopez-
RefAuthors Trascasa, M., Spath, P., Meo, T., Tosi, M.
RefTitle Crucial residues in the carboxy-terminal end of C1
RefTitle inhibitor revealed by pathogenic mutants impaired in
RefTitle secretion or function.
RefLoc J Clin Invest 95:350-359 (1995)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18040
Feature /change: c -> g
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1526
Feature /codon: cct -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 489
Feature /change: P -> R
Diagnosis HAE
//
ID V490D(1); standard; MUTATION;
Accession S0137
Systematic name g.18043T>A, c.1469T>A, r.1469u>a, p.Val490Asp
Original code BX
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18043
Feature /change: t -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1529
Feature /codon: gtc -> gac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 490
Feature /change: V -> D
Diagnosis HAE Type I
Family history Inherited
//
ID M492K(1a); standard; MUTATION;
Accession S0092
Systematic name g.18049T>A, c.1475T>A, r.1475u>a, p.Met492Lys
Original code P3
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 03-Aug-2004 (Rel. 1, Created)
Date 03-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11161971
RefAuthors Bowen, B., Hawk, J. J., Sibunka, S., Hovick, S., Weiler,
RefAuthors J. M.
RefTitle A review of the reported defects in the human C1 esterase
RefTitle inhibitor gene producing hereditary angioedema including
RefTitle four new mutations.
RefLoc Clin Immunol 98:157-163 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18049
Feature /change: t -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1535
Feature /codon: atg -> aag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 492
Feature /change: M -> K
Diagnosis HAE Type I
Relative SERPING1base; S0093 sister
//
ID M492K(1b); standard; MUTATION;
Accession S0093
Systematic name g.18049T>A, c.1475T>A, r.1475u>a, p.Met492Lys
Original code P4
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 03-Aug-2004 (Rel. 1, Created)
Date 03-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11161971
RefAuthors Bowen, B., Hawk, J. J., Sibunka, S., Hovick, S., Weiler,
RefAuthors J. M.
RefTitle A review of the reported defects in the human C1 esterase
RefTitle inhibitor gene producing hereditary angioedema including
RefTitle four new mutations.
RefLoc Clin Immunol 98:157-163 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18049
Feature /change: t -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1535
Feature /codon: atg -> aag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 492
Feature /change: M -> K
Diagnosis HAE Type I
Relative SERPING1base; S0092 brother
//
ID G493E(1); standard; MUTATION;
Accession S0138
Systematic name g.18052G>A, c.1478G>A, r.1478g>a, p.Gly493Glu
Original code AV
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18052
Feature /change: g -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1538
Feature /codon: ggg -> gag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 493
Feature /change: G -> E
Diagnosis HAE Type I
Family history Inherited
//
ID G493E(2); standard; MUTATION;
Accession S0157
Systematic name g.18052G>A, c.1478G>A, r.1478g>a, p.Gly493Glu
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18052
Feature /change: g -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1538
Feature /codon: ggg -> gag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 493
Feature /change: G -> E
Diagnosis HAE Type I
Ethnic origin Caucasoid; Hungary
//
ID G493R(1); standard; MUTATION;
Accession S0050
Systematic name g.18051G>A, c.1477G>A, r.1477g>a, p.Gly493Arg
Original code 21-year-old woman
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 30-Jul-2004 (Rel. 1, Created)
Date 30-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11315937
RefAuthors Sugiyama, E., Ozawa, T., Taki, H., Maruyama, M.,
RefAuthors Yamashita, N., Ohta, M., Hirata, M., Kobayashi, M.
RefTitle Hereditary angioedema with a de novo mutation of exon 8
RefTitle in the C1 inhibitor gene showing recurrent edema of the
RefTitle hands around the peripheral joints: importance for the
RefTitle differential diagnosis of joint swelling.
RefLoc Arthritis Rheum 44:974-977 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18051
Feature /change: g -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1537
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 493
Feature /change: G -> R
Diagnosis HAE Type I
Protein exp. C1 inhibitor protein 5 mg/dl, C1 inhibitor activity <25%
Sex XX
Family history De novo
//
ID R494X(1); standard; MUTATION;
Accession S0022
Systematic name g.18054C>T, c.1480C>T, r.1480c>u, p.Arg494X
Original code F:12
Description A point mutation in the exon 8 leading to a premature stop
Description codon
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
RefNumber [2]
RefCrossRef PUBMED; 7814636
RefAuthors Verpy, E., Couture-Tosi, E., Eldering, E., Lopez-
RefAuthors Trascasa, M., Spath, P., Meo, T., Tosi, M.
RefTitle Crucial residues in the carboxy-terminal end of C1
RefTitle inhibitor revealed by pathogenic mutants impaired in
RefTitle secretion or function.
RefLoc J Clin Invest 95:350-359 (1995)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18054
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1540
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 494
Feature /change: R -> X
Diagnosis HAE
//
ID R494X(2); standard; MUTATION;
Accession S0023
Systematic name g.18054C>T, c.1480C>T, r.1480c>u, p.Arg494X
Original code F:22
Description A point mutation in the exon 8 leading to a premature stop
Description codon
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
RefNumber [2]
RefCrossRef PUBMED; 7814636
RefAuthors Verpy, E., Couture-Tosi, E., Eldering, E., Lopez-
RefAuthors Trascasa, M., Spath, P., Meo, T., Tosi, M.
RefTitle Crucial residues in the carboxy-terminal end of C1
RefTitle inhibitor revealed by pathogenic mutants impaired in
RefTitle secretion or function.
RefLoc J Clin Invest 95:350-359 (1995)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18054
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1540
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 494
Feature /change: R -> X
Diagnosis HAE
//
ID R494X(3); standard; MUTATION;
Accession S0076
Systematic name g.18054C>T, c.1480C>T, r.1480c>u, p.Arg494X
Original code Kindred 16
Description A point mutation in the exon 8 leading to a premature stop
Description codon
Date 02-Aug-2004 (Rel. 1, Created)
Date 02-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10719305
RefAuthors Zuraw, B. L., Herschbach, J.
RefTitle Detection of C1 inhibitor mutations in patients with
RefTitle hereditary angioedema.
RefLoc J Allergy Clin Immunol 105:541-546 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18054
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1540
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 494
Feature /change: R -> X
Diagnosis HAE Type I
//
ID R494X(4); standard; MUTATION;
Accession S0139
Systematic name g.18054C>T, c.1480C>T, r.1480c>u, p.Arg494X
Original code AP
Description A point mutation in the exon 8 leading to a premature stop
Description codon
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18054
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1540
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 494
Feature /change: R -> X
Diagnosis HAE Type I
Family history De novo
//
ID R494X(5); standard; MUTATION;
Accession S0140
Systematic name g.18054C>T, c.1480C>T, r.1480c>u, p.Arg494X
Original code AR
Description A point mutation in the exon 8 leading to a premature stop
Description codon
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18054
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1540
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 494
Feature /change: R -> X
Diagnosis HAE Type I
Family history Inherited
//
ID R494X(6); standard; MUTATION;
Accession S0141
Systematic name g.18054C>T, c.1480C>T, r.1480c>u, p.Arg494X
Original code BY
Description A point mutation in the exon 8 leading to a premature stop
Description codon
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18054
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1540
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 494
Feature /change: R -> X
Diagnosis HAE Type I
Family history Inherited
//
ID R494X(7); standard; MUTATION;
Accession S0142
Systematic name g.18054C>T, c.1480C>T, r.1480c>u, p.Arg494X
Original code DR
Description A point mutation in the exon 8 leading to a premature stop
Description codon
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18054
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1540
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 494
Feature /change: R -> X
Diagnosis HAE Type I
Family history Inherited
//
ID R494X(8); standard; MUTATION;
Accession S0143
Systematic name g.18054C>T, c.1480C>T, r.1480c>u, p.Arg494X
Original code Q
Description A point mutation in the exon 8 leading to a premature stop
Description codon
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18054
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1540
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 494
Feature /change: R -> X
Diagnosis HAE Type I
Family history Inherited
//
ID R494X(9); standard; MUTATION;
Accession S0161
Systematic name g.18054C>T, c.1480C>T, r.1480c>u, p.Arg494X
Description A point mutation in the exon 8 leading to a premature stop
Description codon
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18054
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0077: 1540
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 494
Feature /change: R -> X
Diagnosis HAE Type I
Ethnic origin Caucasoid; Hungary
//
ID P498R(1); standard; MUTATION;
Accession S0158
Systematic name g.18067C>G, c.1493C>G, r.1493c>g, p.Pro498Arg
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18067
Feature /change: c -> g
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1553
Feature /codon: ccc -> cgc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 498
Feature /change: P -> R
Diagnosis HAE Type I
Ethnic origin Caucasoid; Hungary
//
ID P498S(1); standard; MUTATION;
Accession S0024
Systematic name g.18066C>T, c.1492C>T, r.1492c>u, p.Pro498Ser
Original code F:30
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
RefNumber [2]
RefCrossRef PUBMED; 7814636
RefAuthors Verpy, E., Couture-Tosi, E., Eldering, E., Lopez-
RefAuthors Trascasa, M., Spath, P., Meo, T., Tosi, M.
RefTitle Crucial residues in the carboxy-terminal end of C1
RefTitle inhibitor revealed by pathogenic mutants impaired in
RefTitle secretion or function.
RefLoc J Clin Invest 95:350-359 (1995)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18066
Feature /change: c -> t
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0077: 1552
Feature /codon: ccc -> tcc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P05155; IC1_HUMAN: 498
Feature /change: P -> S
Diagnosis HAE
//
ID @X501+85(1); standard; MUTATION;
Accession S0144
Systematic name g.18075T>A, c.1501T>A, r.1501u>a, p.501
Original code X
Description A point mutation in the exon 8 leading to an amino acid
Description change
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12402344
RefAuthors Blanch, A., Roche, O., Lopez-Granados, E., Fontan, G.,
RefAuthors Lopez-Trascasa, M.
RefTitle Detection of C1 inhibitor (SERPING1/C1NH) mutations in
RefTitle exon 8 in patients with hereditary angioedema: evidence
RefTitle for 10 novel mutations.
RefLoc Hum Mutat 20:405-406 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 18075
Feature /change: t -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: terminator
Feature /loc: IDRefSeq: C0077: 1561
Feature aa; 3
Feature /rnalink: 2
Feature /name: elongation
Feature /loc: UniProt: P05155; IC1_HUMAN: 501
Feature /change: X ->
Feature /change: RDLQDQVRAS ATSPASALSC SPAAACLDLP LPPPASGVRY
Feature /change: PPKGLLRVWA RDLLLLALLH GPAMLSKPLF AAFSSSSSPD
Feature /change: SINKTX
Diagnosis HAE Type I
Family history Inherited
//
ID Intron 1(1); standard; MUTATION;
Accession S0046
Systematic name g.IVS1-1G>A, c.-21-1G>A, r.-21-1g>a,
Original code A:36
Description A point mutation in the intron 1 leading to an amino acid
Description change
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 1746
Feature /change: g -> a
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
//
ID Intron 2(1); standard; MUTATION;
Accession S0047
Systematic name g.IVS2+5G>A, c.51+5G>A, r.51+5g>a,
Original code A:46
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 1824
Feature /change: g -> a
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
//
ID Intron 2(2); standard; MUTATION;
Accession S0109
Systematic name g.IVS2-2A>, c.52-2A>, r.52-2a>,
Original code Patient 41
Description A deletion in the intron 2 leading to an aberrant splicing
Date 04-Aug-2004 (Rel. 1, Created)
Date 04-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11112899
RefAuthors Pappalardo, E., Cicardi, M., Duponchel, C., Carugati, A.,
RefAuthors Choquet, S., Agostoni, A., Tosi, M.
RefTitle Frequent de novo mutations and exon deletions in the
RefTitle C1inhibitor gene of patients with angioedema.
RefLoc J Allergy Clin Immunol 106:1147-1154 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 3376
Feature /change: -a
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE
//
ID Intron 2(3); standard; MUTATION;
Accession S0167
Systematic name g.IVS2+1G>A, c.51+1G>A, r.51+1g>a,
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 1820
Feature /change: g -> a
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; Hungary
//
ID Intron 2(4); standard; MUTATION;
Accession S0168
Systematic name g.IVS2+1G>A, c.51+1G>A, r.51+1g>a,
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 1820
Feature /change: g -> a
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; Hungary
//
ID Intron 2(5); standard; MUTATION;
Accession S0198
Systematic name g.IVS2+3A>G, c.51+3A>G, r.51+3a>g,
Original code DA
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 1822
Feature /change: a -> g
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +3
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID Intron 2(6); standard; MUTATION;
Accession S0199
Systematic name g.IVS2+3A>G, c.51+3A>G, r.51+3a>g,
Original code DB
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 1822
Feature /change: a -> g
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +3
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID Intron 3(1); standard; MUTATION;
Accession S0169
Systematic name g.IVS3+1G>A, c.550+1G>A, r.550+1g>a,
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3877
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; Hungary
//
ID Intron 3(2); standard; MUTATION;
Accession S0170
Systematic name g.IVS3+3>T, c.550+3>T, r.550+3>u,
Description A duplication in the intron 3 leading to an aberrant
Description splicing
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0077: 3879
Feature /change: +t
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +3
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; Hungary
//
ID Intron 3(3); standard; MUTATION;
Accession S0217
Systematic name g.IVS3+2T>C, c.550+2T>C, r.550+2u>c,
Original code D
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3878
Feature /change: t -> c
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
Family history De novo
//
ID Intron 3(4); standard; MUTATION;
Accession S0218
Systematic name g.IVS3+5G>C, c.550+5G>C, r.550+5g>c,
Original code J
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3881
Feature /change: g -> c
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID Intron 3(5); standard; MUTATION;
Accession S0219
Systematic name g.IVS3+5G>C, c.550+5G>C, r.550+5g>c,
Original code M
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3881
Feature /change: g -> c
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID Intron 3(6); standard; MUTATION;
Accession S0220
Systematic name g.IVS3+5G>A, c.550+5G>A, r.550+5g>a,
Original code BJ
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 3881
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID Intron 3(7); standard; MUTATION;
Accession S0221
Systematic name g.IVS3-2A>, c.551-2A>, r.551-2a>,
Original code BT
Description A deletion in the intron 3 leading to aberrant splicing
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 5531
Feature /change: -a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0077: 611..745
Feature /change: -gggctgggca gaacaccaaa acaaacctgg agagcatcct
Feature /change: ctcttacccc aaggacttca cctgtgtcca ccaggccctg
Feature /change: aagggcttca cgaccaaagg tgtcacctca gtctctcaga
Feature /change: tcttccacag cccag
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P05155; IC1_HUMAN: 184..229
Feature /change: GAGQNTKTNL ESILSYPKDF TCVHQALKGF TTKGVTSVSQ
Feature /change: IFHSPD
Feature /change: ->
Feature /change: D
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID Intron 4(1); standard; MUTATION;
Accession S0226
Systematic name g.IVS4-3C>G, c.686-3C>G, r.686-3c>g,
Original code DY
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 9504
Feature /change: c -> g
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0077: 746..949
Feature /change: -acctggccat aagggacacc tttgtgaatg cctctcggac
Feature /change: cctgtacagc agcagcccca gagtcctaag caacaacagt
Feature /change: gacgccaact tggagctcat caacacctgg gtggccaaga
Feature /change: acaccaacaa caagatcagc cggctgctag acagtctgcc
Feature /change: ctccgatacc cgccttgtcc tcctcaatgc tatctacctg
Feature /change: agtg
Feature /note: skipping of exon 5
Feature /inexloc: -3
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P05155; IC1_HUMAN: 229..297
Feature /change: DLAIRDTFVN ASRTLYSSSP RVLSNNSDAN LELINTWVAK
Feature /change: NTNNKISRLL DSLPSDTRLV LLNAIYLSA
Feature /change: ->
Feature /change: A
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID Intron 5(1); standard; MUTATION;
Accession S0090
Systematic name g.IVS5-2A>G, c.890-2A>G, r.890-2a>g,
Original code P1
Description A point mutation in the intron 5 leading to aberrant
Description splicing
Date 03-Aug-2004 (Rel. 1, Created)
Date 03-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11161971
RefAuthors Bowen, B., Hawk, J. J., Sibunka, S., Hovick, S., Weiler,
RefAuthors J. M.
RefTitle A review of the reported defects in the human C1 esterase
RefTitle inhibitor gene producing hereditary angioedema including
RefTitle four new mutations.
RefLoc Clin Immunol 98:157-163 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 9903
Feature /change: a -> g
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Family history Inherited
//
ID Intron 5(2); standard; MUTATION;
Accession S0234
Systematic name g.IVS5+2T>C, c.889+2T>C, r.889+2u>c,
Original code A
Description A point mutation in the intron 5 leading to aberrant
Description splicing
Date 25-Aug-2005 (Rel. 1, Created)
Date 25-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 9712
Feature /change: t -> c
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0077: 746..949
Feature /change: -acctggccat aagggacacc tttgtgaatg cctctcggac
Feature /change: cctgtacagc agcagcccca gagtcctaag caacaacagt
Feature /change: gacgccaact tggagctcat caacacctgg gtggccaaga
Feature /change: acaccaacaa caagatcagc cggctgctag acagtctgcc
Feature /change: ctccgatacc cgccttgtcc tcctcaatgc tatctacctg
Feature /change: agtg
Feature /note: also wild type mRNA is detected
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P05155; IC1_HUMAN: 229..297
Feature /change: DLAIRDTFVN ASRTLYSSSP RVLSNNSDAN LELINTWVAK
Feature /change: NTNNKISRLL DSLPSDTRLV LLNAIYLSA
Feature /change: ->
Feature /change: A
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
Family history De novo
//
ID Intron 5(3); standard; MUTATION;
Accession S0260
Systematic name g.IVS5-1G>A, c.890-1G>A, r.890-1g>a,
Original code 59-year-old man
Description A point mutation in the intron 5 leading to aberrant
Description splicing
Date 30-Aug-2005 (Rel. 1, Created)
Date 30-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15098611
RefAuthors Sekijima, Y., Hashimoto, T., Kawachi, Y., Koshihara, H.,
RefAuthors Otsuka, F., Ikeda, S.
RefTitle A novel RNA splice site mutation in the C1 inhibitor gene
RefTitle of a patient with type I hereditary angioedema.
RefLoc Intern Med 43:253-255 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 9904
Feature /change: g -> a
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Protein exp. C1 inhibitor decreased to 7.0 mg/dl with reduced activity
Protein exp. <25%
Symptoms recurrent episodes of subcutaneous edema and abdominal pain
Sex XY
Ethnic origin Mongoloid; Japan
//
ID Intron 6(1); standard; MUTATION;
Accession S0013
Systematic name g.IVS6+1G>T, c.1029+1G>T, r.1029+1g>u,
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 18-Jun-2004 (Rel. 1, Created)
Date 18-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1684567
RefAuthors Siddique, Z., McPhaden, A. R., Lappin, D. F., Whaley, K.
RefTitle An RNA splice site mutation in the C1-inhibitor gene
RefTitle causes type I hereditary angio-oedema.
RefLoc Hum Genet 88:231-232 (1991)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 10045
Feature /change: g -> t
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
//
ID Intron 6(2); standard; MUTATION;
Accession S0041
Systematic name g.IVS6-12CTTATTTTCTAGGTGGGGCAGCTGCAGC>,
Systematic name c.1030-12CTTATTTTCTAGGTGGGGCAGCTGCAGC>,
Systematic name r.1030-12cuuauuuucuagguggggcagcugcagc>,
Original code E:13
Description A deletion in the intron 6 leading to aberrant splicing
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 15201..15228
Feature /change: -cttattttct aggtggggca gctgcagc
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -12
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
//
ID Intron 6(3); standard; MUTATION;
Accession S0042
Systematic name g.IVS6-2AGGT>GCA, c.1030-2AGGT>GCA, r.1030-2aggu>gca,
Original code E:29
Description An indel in the intron 6 leading to aberrant splicing
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0077: 15211..15214
Feature /change: aggt -> gca
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
//
ID Intron 6(4); standard; MUTATION;
Accession S0043
Systematic name g.IVS6-1G>C, c.1030-1G>C, r.1030-1g>c,
Original code E:15
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15212
Feature /change: g -> c
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
//
ID Intron 6(5); standard; MUTATION;
Accession S0232
Systematic name g.9703C>G, c.882C>G, r.882c>g
Original code DG
Description A point mutation in the end of exon 5 leading to aberrant
Description splicing
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 9703
Feature /change: c -> g
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0077: 746..949
Feature /change: -acctggccat aagggacacc tttgtgaatg cctctcggac
Feature /change: cctgtacagc agcagcccca gagtcctaag caacaacagt
Feature /change: gacgccaact tggagctcat caacacctgg gtggccaaga
Feature /change: acaccaacaa caagatcagc cggctgctag acagtctgcc
Feature /change: ctccgatacc cgccttgtcc tcctcaatgc tatctacctg
Feature /change: agtg
Feature /note: also wild type mRNA detected
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P05155; IC1_HUMAN: 229..297
Feature /change: DLAIRDTFVN ASRTLYSSSP RVLSNNSDAN LELINTWVAK
Feature /change: NTNNKISRLL DSLPSDTRLV LLNAIYLSA
Feature /change: ->
Feature /change: A
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID Upstream(1),Upstream(1); standard; MUTATION;
Accession S0048
Systematic name Allele 1 and 2: g.c.r.
Original code A:44
Description Allele 1 and 2: A point mutation in the promoter region
Description 103 bp to upstream from cDNA start point
Date 29-Jul-2004 (Rel. 1, Created)
Date 29-Jul-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8755917
RefAuthors Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T.,
RefAuthors Tosi, M.
RefTitle Exhaustive mutation scanning by fluorescence-assisted
RefTitle mismatch analysis discloses new genotype-phenotype
RefTitle correlations in angiodema.
RefLoc Am J Hum Genet 59:308-319 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 1080
Feature /change: c -> t
Feature /genomic_region: 5' UTR
Feature /genomic_region: promoter
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: upstream
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0077: 1080
Feature /change: c -> t
Feature /genomic_region: 5' UTR
Feature /genomic_region: promoter
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: upstream
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Diagnosis HAE
//
ID Intron 6(5a); standard; MUTATION;
Accession S0173
Systematic name g.IVS6-1G>A, c.1030-1G>A, r.1030-1g>a,
Original code P-1
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14569137
RefAuthors Cumming, S. A., Halsall, D. J., Ewan, P. W., Lomas, D. A.
RefTitle The effect of sequence variations within the coding
RefTitle region of the C1 inhibitor gene on disease expression and
RefTitle protein function in families with hereditary angio-oedema.
RefLoc J Med Genet 40:e114 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15212
Feature /change: g -> a
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Sex XX
Relative SERPING1base; S0174; son
//
ID Intron 6(5b); standard; MUTATION;
Accession S0174
Systematic name g.IVS6-1G>A, c.1030-1G>A, r.1030-1g>a,
Original code P-2
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 05-Aug-2004 (Rel. 1, Created)
Date 05-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14569137
RefAuthors Cumming, S. A., Halsall, D. J., Ewan, P. W., Lomas, D. A.
RefTitle The effect of sequence variations within the coding
RefTitle region of the C1 inhibitor gene on disease expression and
RefTitle protein function in families with hereditary angio-oedema.
RefLoc J Med Genet 40:e114 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15212
Feature /change: g -> a
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Sex XY
Family history Inherited
Relative SERPING1base; S0173; mother
//
ID Intron 7(1); standard; MUTATION;
Accession S0088
Systematic name g.IVS7+2T>A, c.1249+2T>A, r.1249+2u>a,
Original code 42 y old Japanese female
Description A point mutation in the intron 7 leading to aberrant
Description splicing
Date 03-Aug-2004 (Rel. 1, Created)
Date 03-Aug-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 9579556
RefAuthors Kawachi, Y., Hibi, T., Yamazaki, S., Otsuka, F.
RefTitle A novel donor splice site mutation in the C1 inhibitor
RefTitle gene of a patient with type I hereditary angioneurotic
RefTitle edema.
RefLoc J Invest Dermatol 110:837-839 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0077: 15434
Feature /change: t -> a
Feature /genomic_region: intron; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Sex XX
Ethnic origin Mongoloid; japan
//
ID Intron 7(2); standard; MUTATION;
Accession S0245
Systematic name g.IVS7+2T>, c.1249+2T>, r.1249+2u>,
Original code B
Description A deletion in the intron 7 leading to aberrant splicing
Date 25-Aug-2005 (Rel. 1, Created)
Date 25-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 15434
Feature /change: -t
Feature /genomic_region: intron; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0077:
Feature /loc: 1090..1309
Feature /change: -gtggggcagc tgcagctctc ccacaatctg agtttggtga
Feature /change: tcctggtacc ccagaacctg aaacatcgtc ttgaagacat
Feature /change: ggaacaggct ctcagccctt ctgttttcaa ggccatcatg
Feature /change: gagaaactgg agatgtccaa gttccagccc actctcctaa
Feature /change: cactaccccg catcaaagtg acgaccagcc aggatatgct
Feature /change: ctcaatcatg gagaaattgg
Feature /change: skipping of exon 7
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P05155; IC1_HUMAN: 344..417
Feature /change: VGQLQLSHNL SLVILVPQNL KHRLEDMEQA LSPSVFKAIM
Feature /change: EKLEMSKFQP TLLTLPRIKV TTSQDMLSIM EKLE
Feature /change: ->
Feature /change: NSSIFLMTLT CVGX
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID Deletion(1); standard; MUTATION;
Accession S0184
Systematic name g.4348_6970del
Original code F4
Description 2.6 kb deletion including the end of intron 3, exon 4 and
Description the beginning of intron 4
Date 30-Jun-2005 (Rel. 1, Created)
Date 30-Jun-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2154751
RefAuthors Stoppa-Lyonnet, D., Carter, P. E., Meo, T., Tosi, M.
RefTitle Clusters of intragenic alu repeats predispose the human C1
RefTitle inhibitor locus to deleterious rearrangements.
RefLoc Proc Natl Acad Sci U S A 87:1551-1555 (1990)
RefNumber [2]
RefCrossRef PUBMED; 1656734
RefAuthors Stoppa-Lyonnet, D., Duponchel, C., Meo, T., Laurent, J.,
RefAuthors Carter, P. E., Arala-Chaves, M., Cohen, J. H., Dewald, G.,
RefAuthors Goetz, J., Hauptmann, G.
RefTitle Recombinational biases in the rearranged C1-inhibitor
RefTitle genes of hereditary angioedema patients.
RefLoc Am J Hum Genet 49:1055-1062 (1991)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 4348..6970
Feature /genomic_region: intron; 3, exon; 4, intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +472
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; France
//
ID Deletion(2); standard; MUTATION;
Accession S0185
Systematic name g.4271_7470del
Original code F1
Description 3.2 kb deletion including the end of intron 3, exon 4 and
Description the beginning of intron 4
Date 30-Jun-2005 (Rel. 1, Created)
Date 30-Jun-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2154751
RefAuthors Stoppa-Lyonnet, D., Carter, P. E., Meo, T., Tosi, M.
RefTitle Clusters of intragenic alu repeats predispose the human C1
RefTitle inhibitor locus to deleterious rearrangements.
RefLoc Proc Natl Acad Sci U S A 87:1551-1555 (1990)
RefNumber [2]
RefCrossRef PUBMED; 1656734
RefAuthors Stoppa-Lyonnet, D., Duponchel, C., Meo, T., Laurent, J.,
RefAuthors Carter, P. E., Arala-Chaves, M., Cohen, J. H., Dewald, G.,
RefAuthors Goetz, J., Hauptmann, G.
RefTitle Recombinational biases in the rearranged C1-inhibitor
RefTitle genes of hereditary angioedema patients.
RefLoc Am J Hum Genet 49:1055-1062 (1991)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 4271..7470
Feature /genomic_region: intron; 3, exon; 4, intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +395
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; France
//
ID Deletion(3); standard; MUTATION;
Accession S0187
Original code F7
Description 2.6 kb deletion including the end of intron 3, exon 4 and
Description the beginning of intron 4
Date 30-Jun-2005 (Rel. 1, Created)
Date 30-Jun-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1656734
RefAuthors Stoppa-Lyonnet, D., Duponchel, C., Meo, T., Laurent, J.,
RefAuthors Carter, P. E., Arala-Chaves, M., Cohen, J. H., Dewald, G.,
RefAuthors Goetz, J., Hauptmann, G.
RefTitle Recombinational biases in the rearranged C1-inhibitor
RefTitle genes of hereditary angioedema patients.
RefLoc Am J Hum Genet 49:1055-1062 (1991)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: unknown
Feature /genomic_region: intron; 3, exon; 4, intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; France
//
ID Deletion(4); standard; MUTATION;
Accession S0188
Original code F42
Description 2.75 kb deletion including the end of intron 3, exon 4 and
Description the beginning of intron 4
Date 30-Jun-2005 (Rel. 1, Created)
Date 30-Jun-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1656734
RefAuthors Stoppa-Lyonnet, D., Duponchel, C., Meo, T., Laurent, J.,
RefAuthors Carter, P. E., Arala-Chaves, M., Cohen, J. H., Dewald, G.,
RefAuthors Goetz, J., Hauptmann, G.
RefTitle Recombinational biases in the rearranged C1-inhibitor
RefTitle genes of hereditary angioedema patients.
RefLoc Am J Hum Genet 49:1055-1062 (1991)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: unknown
Feature /genomic_region: intron; 3, exon; 4, intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; Italy
//
ID Deletion(5); standard; MUTATION;
Accession S0189
Original code F8
Description >17 kb deletion encompassing exons 1-6 and 5'-flanking
Description region
Date 30-Jun-2005 (Rel. 1, Created)
Date 30-Jun-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1656734
RefAuthors Stoppa-Lyonnet, D., Duponchel, C., Meo, T., Laurent, J.,
RefAuthors Carter, P. E., Arala-Chaves, M., Cohen, J. H., Dewald, G.,
RefAuthors Goetz, J., Hauptmann, G.
RefTitle Recombinational biases in the rearranged C1-inhibitor
RefTitle genes of hereditary angioedema patients.
RefLoc Am J Hum Genet 49:1055-1062 (1991)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: unknown
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; France
//
ID Deletion(6); standard; MUTATION;
Accession S0190
Original code F3
Description 4 kb deletion encompassing exons 1-3 and 5'-flanking
Description region
Date 30-Jun-2005 (Rel. 1, Created)
Date 30-Jun-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1656734
RefAuthors Stoppa-Lyonnet, D., Duponchel, C., Meo, T., Laurent, J.,
RefAuthors Carter, P. E., Arala-Chaves, M., Cohen, J. H., Dewald, G.,
RefAuthors Goetz, J., Hauptmann, G.
RefTitle Recombinational biases in the rearranged C1-inhibitor
RefTitle genes of hereditary angioedema patients.
RefLoc Am J Hum Genet 49:1055-1062 (1991)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: unknown
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; France
//
ID Deletion(7); standard; MUTATION;
Accession S0191
Original code F32
Description >9 kb deletion encompassing exons 1-4 and 5'-flanking
Description region
Date 30-Jun-2005 (Rel. 1, Created)
Date 30-Jun-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1656734
RefAuthors Stoppa-Lyonnet, D., Duponchel, C., Meo, T., Laurent, J.,
RefAuthors Carter, P. E., Arala-Chaves, M., Cohen, J. H., Dewald, G.,
RefAuthors Goetz, J., Hauptmann, G.
RefTitle Recombinational biases in the rearranged C1-inhibitor
RefTitle genes of hereditary angioedema patients.
RefLoc Am J Hum Genet 49:1055-1062 (1991)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: unknown
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID Deletion(8); standard; MUTATION;
Accession S0192
Original code F2
Description 3.5 kb deletion around exon 8
Date 30-Jun-2005 (Rel. 1, Created)
Date 30-Jun-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1656734
RefAuthors Stoppa-Lyonnet, D., Duponchel, C., Meo, T., Laurent, J.,
RefAuthors Carter, P. E., Arala-Chaves, M., Cohen, J. H., Dewald, G.,
RefAuthors Goetz, J., Hauptmann, G.
RefTitle Recombinational biases in the rearranged C1-inhibitor
RefTitle genes of hereditary angioedema patients.
RefLoc Am J Hum Genet 49:1055-1062 (1991)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: unknown
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; France
//
ID Deletion(9); standard; MUTATION;
Accession S0193
Original code 15-year-old girl
Description >17 kb deletion including exons 5-8
Date 01-Jul-2005 (Rel. 1, Created)
Date 01-Jul-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8403537
RefAuthors Ariga, T., Hoshioka, A., Kohno, Y., Sakamaki, T.,
RefAuthors Matsumoto, S.
RefTitle A de novo deletion in the C1 inhibitor gene in a case of
RefTitle sporadic hereditary angioneurotic edema.
RefLoc Clin Immunol Immunopathol 69:103-105 (1993)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: unknown
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Protein exp. C1 inhibitor activity less than 25% of normal value
Symptoms Recurrent episodes of urticaria-like skin edema, followed
Symptoms by vomiting with abdominal pain
Sex XX
Family history De novo
//
ID Deletion(10); standard; MUTATION;
Accession S0194
Description 9 kb deletion
Date 01-Jul-2005 (Rel. 1, Created)
Date 01-Jul-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14635117
RefAuthors Kalmar, L., Bors, A., Farkas, H., Vas, S., Fandl, B.,
RefAuthors Varga, L., Fust, G., Tordai, A.
RefTitle Mutation screening of the C1 inhibitor gene among
RefTitle hungarian patients with hereditary angioedema.
RefLoc Hum Mutat 22:498 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: unknown
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; Hungary
//
ID Deletion(11); standard; MUTATION;
Accession S0196
Original code Patient B
Description 8.5 kb deletion including exons 4-6
Date 24-Aug-2005 (Rel. 1, Created)
Date 24-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2276734
RefAuthors Ariga, T., Carter, P. E., Davis, A. E.
RefTitle Recombinations between alu repeat sequences that result in
RefTitle partial deletions within the C1 inhibitor gene.
RefLoc Genomics 8:607-613 (1990)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: unknown
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Family history Inherited
//
ID Deletion(12); standard; MUTATION;
Accession S0246
Original code Patient 191
Description Deletion of exon 4
Date 29-Aug-2005 (Rel. 1, Created)
Date 29-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11139243
RefAuthors Duponchel, C., Di Rocco, C., Cicardi, M., Tosi, M.
RefTitle Rapid detection by fluorescent multiplex PCR of exon
RefTitle deletions and duplications in the C1 inhibitor gene of
RefTitle hereditary angioedema patients.
RefLoc Hum Mutat 17:61-70 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: unknown
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
//
ID Deletion(13); standard; MUTATION;
Accession S0247
Original code Patient 181
Description ~5.5 kb deletion including exons 5-6
Date 29-Aug-2005 (Rel. 1, Created)
Date 29-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11139243
RefAuthors Duponchel, C., Di Rocco, C., Cicardi, M., Tosi, M.
RefTitle Rapid detection by fluorescent multiplex PCR of exon
RefTitle deletions and duplications in the C1 inhibitor gene of
RefTitle hereditary angioedema patients.
RefLoc Hum Mutat 17:61-70 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: unknown
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
//
ID Deletion(14); standard; MUTATION;
Accession S0248
Original code Patient 111
Description >15 kb deletion of complete gene
Date 29-Aug-2005 (Rel. 1, Created)
Date 29-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11139243
RefAuthors Duponchel, C., Di Rocco, C., Cicardi, M., Tosi, M.
RefTitle Rapid detection by fluorescent multiplex PCR of exon
RefTitle deletions and duplications in the C1 inhibitor gene of
RefTitle hereditary angioedema patients.
RefLoc Hum Mutat 17:61-70 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: unknown
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
//
ID Deletion(15); standard; MUTATION;
Accession S0249
Original code F
Description >15kb deletion affecting exons 1-8
Date 29-Aug-2005 (Rel. 1, Created)
Date 29-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: unknown
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Family history Inherited
Ethnic origin Caucasoid; Spain
//
ID Deletion(16); standard; MUTATION;
Accession S0250
Original code BA
Description >15kb deletion affecting exons 1-8
Date 29-Aug-2005 (Rel. 1, Created)
Date 29-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: unknown
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID Deletion(17); standard; MUTATION;
Accession S0251
Original code AB
Description 2.9 kb deletion including exon 4 leading to aberrant
Description splicing
Date 29-Aug-2005 (Rel. 1, Created)
Date 29-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0077: 4375..7263
Feature /change: -aggaggtgga ggttgcagtg agccgagacc gcaccattgc
Feature /change: actacagtct gggtgacaga gcgagactct gtctcaaaaa
Feature /change: aaaaaaaaat tatcagagat agacctagag tagatgtggt
Feature /change: tagtactgcc ttctagctct gtgaccttgg gcagatcact
Feature /change: ttaacctctc tgagccttga gtcctcttgt gtaaaatagt
Feature /change: gatgatgcta tctacctcaa aagattaaga agcagaaagc
Feature /change: caggccgggt gcggtggttc acacctgtaa tcccagcatt
Feature /change: ttaggaggcc gaggagggca gatcacgagg tcaggagttc
Feature /change: gagaccagcc tgactaacat ggtgaaaccc cgtctctact
Feature /change: aaaaataaaa agaaattagc taggcatggt ggtgcacacc
Feature /change: tgtaacccca gctactcagg aggctgaggc aggagaatca
Feature /change: cttgaacacg ggaggcagag gttgcagtga gccgaaatca
Feature /change: tgccactgca ctccagcctg ggaagactga gcaagactct
Feature /change: gtctcaaaaa aaaaaaaaag aagcagccta gtgtctgact
Feature /change: tagtgggagg tcaaaaaaat gtaaatcctc tgccatcttg
Feature /change: agggattact gtcaagtccc atttggtaat taccctagga
Feature /change: atggcacaaa caaattacta caagcagtgg ggacagagct
Feature /change: attactcccc agagagaatt ctaaaaaggc tacagaatct
Feature /change: ttcttggctg ggcacggtga ctcacaccta taatcctggc
Feature /change: actttgggag gccaaggcag gagttcaaga ccagcctggc
Feature /change: caacatgttg aaaccccatc tctactaaaa atgcaaaaat
Feature /change: tagccaggca tagtgatgca tgcttattgt cccagctact
Feature /change: tgggaggcag aggtgggagg attgcttgaa cctggagatt
Feature /change: caagtgagct gagattgcac cactgcattc cagcctgggc
Feature /change: caacaaagca agactctgtc tcaaaaaaaa aaaaaaaaaa
Feature /change: aaaagagaga gattgagaga acattccagc tcagatgatc
Feature /change: tgtgatcccc tccaaagcag ggaataccct ccattccagc
Feature /change: ctggtcccca accctcattc ccaaggaagg cccccgactc
Feature /change: atcctgcaag tatctttcat ctctgccctt tgttgcaggg
Feature /change: gctggggaga acaccaaaac aaacctggag agcatcctct
Feature /change: cttaccccaa ggacttcacc tgtgtccacc aggccctgaa
Feature /change: gggcttcacg accaaaggtg tcacctcagt ctctcagatc
Feature /change: ttccacagcc caggtgagtg cccaggaatg ggcagtgtct
Feature /change: gcagaggagg gtcctgagag gactctgaag ggggacccag
Feature /change: cgctggggaa agaaaggaca gagggaatgt tggagctaca
Feature /change: gtatcaggga tggactgcag agcaggtgaa gaccttggca
Feature /change: ggagcattag gtcactccag gaactagact gttcttctaa
Feature /change: tgagacctta gacaagtctc tggcattcat caactgcttt
Feature /change: agaataaaaa taaccgggca ggtacagtaa aatagtgatg
Feature /change: atgctatcta cctcaaaaga ttaagaagca gaaagccagg
Feature /change: ctgggcgtgg tggctcacac ctgtaatccc agcactttgg
Feature /change: gaggccgagg caggtggatc acgaggtcag gggttcgaga
Feature /change: ccagcctgac caacatggtg aaaccctgtc tctactaaaa
Feature /change: atacaaaaat tagctgggca tggtggcggg cacctgtaat
Feature /change: cccagctatt caggaggctg aggcaggaga attgcttgaa
Feature /change: cctgggaggc ggaggttgca gtgagccgag atgacgccac
Feature /change: tgcactccag cctgggcgac agagcaagac tccgtctcaa
Feature /change: aaaaaaaaac aaaaacaaaa caaaaacaaa aaaaaaaaac
Feature /change: aaagaaggag aaagccgggc cgggcatggt ggttctcatc
Feature /change: tgtaagttca aggagttgaa ggtatgctag gactttggga
Feature /change: ggccaaggcc ttcaagacca gcctgggcag catggcgaaa
Feature /change: cctgtctcca ttaaaaaaaa aaaagttggg ggtacggctg
Feature /change: ggcatggtgg ctcacacctg taatcccagc acttttggga
Feature /change: ggctgaggtg ggtggaacac ctgaggtcag gagttcaaga
Feature /change: ccagcctggc caacatggca aaaccctgtc tctattaaaa
Feature /change: acacaaaaat tagcctggca tggtggcagg cgcctataat
Feature /change: cccaactact caggaggctg aggcaggaga atcgcttgaa
Feature /change: cccaagagag tgaaggttgc agtgagctga gatcatgcca
Feature /change: cttcactcca gcctgagtga aacagcaaaa ctctgtctca
Feature /change: aaaaaaaaaa aaggaagaaa gaaaaaaggc caggcgcggt
Feature /change: gactcacgcc tgtaatcgca acactttggc aggccgaggc
Feature /change: aggcgattca caaggtcagg agttcgagac cagtctggct
Feature /change: aactaacata gtgaaactcc gtctctactg aaaatacaag
Feature /change: aaattaccct ggcatggtgg tgtgcacctg taatcccagc
Feature /change: tactcaggag gctgaggcag gagaatcgct tgaacctggg
Feature /change: aggcagaggc tgcagtgagc cgagatcgcg ccactgcact
Feature /change: ccagcctgga tgacagagca agactctgtc tcaaaaaaaa
Feature /change: aaggccgggc gcggtggctc atgcctgtaa tcccagcact
Feature /change: ttgggaggct gaggcgggcg gaccacgagg tcagaagatc
Feature /change: aagaccatcc tggctaacaa gatgaaaccc tgtctctgcc
Feature /change: aaaaaaatac aaaacttagc cgggcatggt ggcaggcgcc
Feature /change: tgtggtccca actacttggg aggctgaggc aggagaatgg
Feature /change: catgaaccc
Feature /genomic_region: intron; 3, exon; 4, intron;4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0077: 611..745
Feature /change: -gggctgggca gaacaccaaa acaaacctgg agagcatcct
Feature /change: ctcttacccc aaggacttca cctgtgtcca ccaggccctg
Feature /change: aagggcttca cgaccaaagg tgtcacctca gtctctcaga
Feature /change: tcttccacag cccag
Feature /note: skipping of exon 4
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P05155; IC1_HUMAN: 184..229
Feature /change: GAGQNTKTNL ESILSYPKDF TCVHQALKGF TTKGVTSVSQ
Feature /change: IFHSPD
Feature /change: ->
Feature /change: D
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID Deletion(18); standard; MUTATION;
Accession S0252
Original code AL
Description 1.4 kb deletion including exon 4 leading to aberrant
Description splicing
Date 29-Aug-2005 (Rel. 1, Created)
Date 29-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: unknown
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0077: 611..745
Feature /change: -gggctgggca gaacaccaaa acaaacctgg agagcatcct
Feature /change: ctcttacccc aaggacttca cctgtgtcca ccaggccctg
Feature /change: aagggcttca cgaccaaagg tgtcacctca gtctctcaga
Feature /change: tcttccacag cccag
Feature /note: skipping of exon 4
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P05155; IC1_HUMAN: 184..229
Feature /change: GAGQNTKTNL ESILSYPKDF TCVHQALKGF TTKGVTSVSQ
Feature /change: IFHSPD
Feature /change: ->
Feature /change: D
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID Deletion(19); standard; MUTATION;
Accession S0253
Original code DC
Description 3.2 kb deletion including exon 4 leading to aberrant
Description splicing
Date 29-Aug-2005 (Rel. 1, Created)
Date 29-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /loc: IDRefSeq: D0077: 4215..7414
Feature /change: -caaggcgggt ggatcacctg aggtcaggag ttcaagacca
Feature /change: gcctggccaa catggtgaaa ccctgtctct actaaaaata
Feature /change: caaaaattat cagggagtgg tggtgcatgc ctgtaatccc
Feature /change: agctacttgg gcagctgagg caggagaatc gcttgaaccc
Feature /change: aggaggtgga ggttgcagtg agccgagacc gcaccattgc
Feature /change: actacagtct gggtgacaga gcgagactct gtctcaaaaa
Feature /change: aaaaaaaaat tatcagagat agacctagag tagatgtggt
Feature /change: tagtactgcc ttctagctct gtgaccttgg gcagatcact
Feature /change: ttaacctctc tgagccttga gtcctcttgt gtaaaatagt
Feature /change: gatgatgcta tctacctcaa aagattaaga agcagaaagc
Feature /change: caggccgggt gcggtggttc acacctgtaa tcccagcatt
Feature /change: ttaggaggcc gaggagggca gatcacgagg tcaggagttc
Feature /change: gagaccagcc tgactaacat ggtgaaaccc cgtctctact
Feature /change: aaaaataaaa agaaattagc taggcatggt ggtgcacacc
Feature /change: tgtaacccca gctactcagg aggctgaggc aggagaatca
Feature /change: cttgaacacg ggaggcagag gttgcagtga gccgaaatca
Feature /change: tgccactgca ctccagcctg ggaagactga gcaagactct
Feature /change: gtctcaaaaa aaaaaaaaag aagcagccta gtgtctgact
Feature /change: tagtgggagg tcaaaaaaat gtaaatcctc tgccatcttg
Feature /change: agggattact gtcaagtccc atttggtaat taccctagga
Feature /change: atggcacaaa caaattacta caagcagtgg ggacagagct
Feature /change: attactcccc agagagaatt ctaaaaaggc tacagaatct
Feature /change: ttcttggctg ggcacggtga ctcacaccta taatcctggc
Feature /change: actttgggag gccaaggcag gagttcaaga ccagcctggc
Feature /change: caacatgttg aaaccccatc tctactaaaa atgcaaaaat
Feature /change: tagccaggca tagtgatgca tgcttattgt cccagctact
Feature /change: tgggaggcag aggtgggagg attgcttgaa cctggagatt
Feature /change: caagtgagct gagattgcac cactgcattc cagcctgggc
Feature /change: caacaaagca agactctgtc tcaaaaaaaa aaaaaaaaaa
Feature /change: aaaagagaga gattgagaga acattccagc tcagatgatc
Feature /change: tgtgatcccc tccaaagcag ggaataccct ccattccagc
Feature /change: ctggtcccca accctcattc ccaaggaagg cccccgactc
Feature /change: atcctgcaag tatctttcat ctctgccctt tgttgcaggg
Feature /change: gctggggaga acaccaaaac aaacctggag agcatcctct
Feature /change: cttaccccaa ggacttcacc tgtgtccacc aggccctgaa
Feature /change: gggcttcacg accaaaggtg tcacctcagt ctctcagatc
Feature /change: ttccacagcc caggtgagtg cccaggaatg ggcagtgtct
Feature /change: gcagaggagg gtcctgagag gactctgaag ggggacccag
Feature /change: cgctggggaa agaaaggaca gagggaatgt tggagctaca
Feature /change: gtatcaggga tggactgcag agcaggtgaa gaccttggca
Feature /change: ggagcattag gtcactccag gaactagact gttcttctaa
Feature /change: tgagacctta gacaagtctc tggcattcat caactgcttt
Feature /change: agaataaaaa taaccgggca ggtacagtaa aatagtgatg
Feature /change: atgctatcta cctcaaaaga ttaagaagca gaaagccagg
Feature /change: ctgggcgtgg tggctcacac ctgtaatccc agcactttgg
Feature /change: gaggccgagg caggtggatc acgaggtcag gggttcgaga
Feature /change: ccagcctgac caacatggtg aaaccctgtc tctactaaaa
Feature /change: atacaaaaat tagctgggca tggtggcggg cacctgtaat
Feature /change: cccagctatt caggaggctg aggcaggaga attgcttgaa
Feature /change: cctgggaggc ggaggttgca gtgagccgag atgacgccac
Feature /change: tgcactccag cctgggcgac agagcaagac tccgtctcaa
Feature /change: aaaaaaaaac aaaaacaaaa caaaaacaaa aaaaaaaaac
Feature /change: aaagaaggag aaagccgggc cgggcatggt ggttctcatc
Feature /change: tgtaagttca aggagttgaa ggtatgctag gactttggga
Feature /change: ggccaaggcc ttcaagacca gcctgggcag catggcgaaa
Feature /change: cctgtctcca ttaaaaaaaa aaaagttggg ggtacggctg
Feature /change: ggcatggtgg ctcacacctg taatcccagc acttttggga
Feature /change: ggctgaggtg ggtggaacac ctgaggtcag gagttcaaga
Feature /change: ccagcctggc caacatggca aaaccctgtc tctattaaaa
Feature /change: acacaaaaat tagcctggca tggtggcagg cgcctataat
Feature /change: cccaactact caggaggctg aggcaggaga atcgcttgaa
Feature /change: cccaagagag tgaaggttgc agtgagctga gatcatgcca
Feature /change: cttcactcca gcctgagtga aacagcaaaa ctctgtctca
Feature /change: aaaaaaaaaa aaggaagaaa gaaaaaaggc caggcgcggt
Feature /change: gactcacgcc tgtaatcgca acactttggc aggccgaggc
Feature /change: aggcgattca caaggtcagg agttcgagac cagtctggct
Feature /change: aactaacata gtgaaactcc gtctctactg aaaatacaag
Feature /change: aaattaccct ggcatggtgg tgtgcacctg taatcccagc
Feature /change: tactcaggag gctgaggcag gagaatcgct tgaacctggg
Feature /change: aggcagaggc tgcagtgagc cgagatcgcg ccactgcact
Feature /change: ccagcctgga tgacagagca agactctgtc tcaaaaaaaa
Feature /change: aaggccgggc gcggtggctc atgcctgtaa tcccagcact
Feature /change: ttgggaggct gaggcgggcg gaccacgagg tcagaagatc
Feature /change: aagaccatcc tggctaacaa gatgaaaccc tgtctctgcc
Feature /change: aaaaaaatac aaaacttagc cgggcatggt ggcaggcgcc
Feature /change: tgtggtccca actacttggg aggctgaggc aggagaatgg
Feature /change: catgaacccg ggaggcggag cttgcagtga gccgagattg
Feature /change: cgccactgca ctccagcctg ggcaacagag cgagacacca
Feature /change: tctcaaaaaa aaaaaaaaaa aatggggcgg gcgggccagg
Feature /change: cgcggtgtct cacacctgta atcccagcac tttgggaggc
Feature /genomic_region: intron; 3, exon; 4, intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0077: 611..745
Feature /change: -gggctgggca gaacaccaaa acaaacctgg agagcatcct
Feature /change: ctcttacccc aaggacttca cctgtgtcca ccaggccctg
Feature /change: aagggcttca cgaccaaagg tgtcacctca gtctctcaga
Feature /change: tcttccacag cccag
Feature /note: skipping of exon 4
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P05155; IC1_HUMAN: 184..229
Feature /change: GAGQNTKTNL ESILSYPKDF TCVHQALKGF TTKGVTSVSQ
Feature /change: IFHSPD
Feature /change: ->
Feature /change: D
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID Deletion(20); standard; MUTATION;
Accession S0255
Original code BE
Description 4.5 kb deletion including exons 5-6
Date 29-Aug-2005 (Rel. 1, Created)
Date 29-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: unknown
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID Deletion(21); standard; MUTATION;
Accession S0257
Original code BV
Description 2.6 kb deletion including exon 7
Date 29-Aug-2005 (Rel. 1, Created)
Date 29-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: unknown
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID Deletion(22); standard; MUTATION;
Accession S0258
Original code DN
Description >3.3 kb deletion affecting exons 7-8
Date 29-Aug-2005 (Rel. 1, Created)
Date 29-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: unknown
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID Deletion(23); standard; MUTATION;
Accession S0259
Original code DJ
Description >1.6 kb deletion affecting exon 8
Date 29-Aug-2005 (Rel. 1, Created)
Date 29-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: unknown
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID Insertion(1); standard; MUTATION;
Accession S0186
Original code F5
Description 3.2 kb duplication of exon 4
Date 30-Jun-2005 (Rel. 1, Created)
Date 30-Jun-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2154751
RefAuthors Stoppa-Lyonnet, D., Carter, P. E., Meo, T., Tosi, M.
RefTitle Clusters of intragenic alu repeats predispose the human C1
RefTitle inhibitor locus to deleterious rearrangements.
RefLoc Proc Natl Acad Sci U S A 87:1551-1555 (1990)
RefNumber [2]
RefCrossRef PUBMED; 1656734
RefAuthors Stoppa-Lyonnet, D., Duponchel, C., Meo, T., Laurent, J.,
RefAuthors Carter, P. E., Arala-Chaves, M., Cohen, J. H., Dewald, G.,
RefAuthors Goetz, J., Hauptmann, G.
RefTitle Recombinational biases in the rearranged C1-inhibitor
RefTitle genes of hereditary angioedema patients.
RefLoc Am J Hum Genet 49:1055-1062 (1991)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: unknown
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; Germany
//
ID Insertion(2); standard; MUTATION;
Accession S0254
Original code DD
Description 1.2 kb duplication of exon 4
Date 30-Jun-2005 (Rel. 1, Created)
Date 30-Jun-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: unknown
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
ID Insertion(3); standard; MUTATION;
Accession S0256
Original code EC
Description ~2 kb duplication of exons 5-6
Date 30-Jun-2005 (Rel. 1, Created)
Date 30-Jun-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15971231
RefAuthors Roche, O., Blanch, A., Duponchel, C., Fontan, G., Tosi,
RefAuthors M., Lopez-Trascasa, M.
RefTitle Hereditary angioedema: the mutation spectrum of
RefTitle SERPING1/C1NH in a large spanish cohort.
RefLoc Hum Mutat 26(2):1-10 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: unknown
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis HAE Type I
Ethnic origin Caucasoid; Spain
//
//
|
