Database IFNGR2base
Version 1.0
File ifngr2pub.html
Date 16-Jun-2011
Curator Mauno Vihinen
Address Protein Structure and Bioinformatics
Address Lund University, BMC D10, SE-22184 Lund, Sweden
Phone +46 72 526 0022
Fax +46 46 222 9328
Email Mauno Vihinen
URL http://structure.bmc.lu.se/idbase/IFNGR2base/
IDR factfile http://structure.bmc.lu.se/idbase/IDRefSeq/xml/idr/ff/FF45.html
Gene IFNGR2
Disease IFN-gamma receptor-1 deficiency
OMIM 147569
GDB 142306
Sequence IDRefSeq:D0042; IDRefSeq:C0042; UniProt:P38484
Numbering start of the entry
Funding Tampere University Hospital Medical Research Fund
Funding European Union
Comments sequence entry reference in every entry
//
ID 130(1),130(1); standard; MUTATION; EC,EC
Accession I0009
Systematic name Allele 1 and 2: g.19761_19766dup, c.382_387dup,
Systematic name r.382_387dup, p.130
Original code P.1
Description Allele 1 and 2: A duplication mutation in the exon 3
Description leading to an amino acid change in the EC domain
Date 28-Jul-2010 (Rel. 1, Created)
Date 28-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18625743
RefAuthors Vogt, G., Bustamante, J., Chapgier, A., Feinberg, J.,
RefAuthors Boisson Dupuis, S., Picard, C., Mahlaoui, N., Gineau, L.,
RefAuthors Alcaxs, A., Lamaze, C., Puck, J. M., de Saint Basile, G.,
RefAuthors Khayat, C. D., Mikhael, R., Casanova, J. L.
RefTitle Complementation of a pathogenic IFNGR2 misfolding mutation
RefTitle with modifiers of N-glycosylation.
RefLoc J Exp Med:1729-1737 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0042: 19767
Feature /change: +acaatg
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe duplication
Feature /loc: IDRefSeq: C0042; GI:463549; IFNGR2C: 1036
Feature aa; 3
Feature /rnalink: 2
Feature /name: duplication; inframe
Feature /loc: UniProt: P38484; INGR2_HUMAN: 130
Feature /change: +TM
Feature /domain: EC
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: duplication
Feature /loc: IDRefSeq: D0042: 19767
Feature /change: +acaatg
Feature /genomic_region: exon; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: inframe duplication
Feature /loc: IDRefSeq: C0042; GI:463549; IFNGR2C: 1036
Feature aa; 6
Feature /rnalink: 5
Feature /name: duplication; inframe
Feature /loc: UniProt: P38484; INGR2_HUMAN: 130
Feature /change: +TM
Feature /domain: EC
Symptoms Mycobacterial infections:
Symptoms M. avium complex (MAC);
Diagnosis Complete IFN-gamma receptor-2 deficiency
Age 2
Sex XX
Parents Consanguineous
Comment Patient died of dissemination and uncontrolled
Comment Mycobacterium avium infection at age 5 years.
//
ID #E93X94(1),#E93X94(1); standard; MUTATION; EC,EC
Accession I0001
Systematic name Allele 1 and 2: g.19657_19658delAG, c.278_279delAG,
Systematic name r.278_279delag, p.Glu93fsX2
Description Allele 1 and 2: a frame shift deletion mutation in the exon
Description 3 leading to a premature stop codon in the EC domain
Date 27-Aug-2003 (Rel. 1, Created)
Date 27-Aug-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 9616207
RefAuthors Dorman, S. E., Holland, S. M.
RefTitle Mutation in the signal-transducing chain of the interferon-
RefTitle gamma receptor and susceptibility to mycobacterial
RefTitle infection.
RefLoc J Clin Invest 101:2364-2369 (1998)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0042: 19657..19658
Feature /change: -ag
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0042: 926..927
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P38484; INGR2_HUMAN: 93
Feature /change: E -> VX
Feature /domain: EC
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0042: 19657..19658
Feature /change: -ag
Feature /genomic_region: exon; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0042: 926..927
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P38484; INGR2_HUMAN: 93
Feature /change: E -> VX
Feature /domain: EC
Symptoms Mycobacterial infections:
Symptoms M. avium complex (MAC);
Symptoms M. fortuitum;
Symptoms Other clinical features: lymphadenopathy,
Symptoms hepatosplenomegaly and fevers
Diagnosis Complete IFN-gamma receptor-2 deficiency
Sex XY
Ethnic origin Caucasoid; English/Portuguese
Parents Non-consanguineous
//
ID R114C(1),R114C(1); standard; MUTATION; EC,EC
Accession I0002
Systematic name Allele 1 and 2: g.19719C>T, c.340C>T, r.340c>u, p.Arg114Cys
Original code Patient 8[2]
Description Allele 1 and 2: a point mutation in the exon 3 leading to
Description an amino acid change in the EC domain
Date 27-Aug-2003 (Rel. 1, Created)
Date 27-Aug-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10608793
RefAuthors Doffinger, R., Jouanguy, E., Dupuis, S., Fondaneche, M.
RefAuthors C., Stephan, J. L., Emile, J. F., Lamhamedi-Cherradi, S.,
RefAuthors Altare, F., Pallier, A., Barcenas-Morales, G., Meinl, E.,
RefAuthors Krause, C., Pestka, S., Schreiber, R. D., Novelli, F.,
RefAuthors Casanova, J. L.
RefTitle Partial interferon-gamma receptor signaling chain
RefTitle deficiency in a patient with bacille calmette-guérin
RefTitle and mycobacterium abscessus infection.
RefLoc J Infect Dis 181:379-384 (2000)
RefNumber [2]
RefCrossRef PUBMED; 8885960
RefAuthors Casanova, J. L., Blanche, S., Emile, J. F., Jouanguy, E.,
RefAuthors Lamhamedi, S., Altare, F., Stephan, J. L., Bernaudin, F.,
RefAuthors Bordigoni, P., Turck, D., Lachaux, A., Albertini, M.,
RefAuthors Bourrillon, A., Dommergues, J. P., Pocidalo, M. A., Le
RefAuthors Deist, F., Gaillard, J. L., Griscelli, C., Fischer, A.
RefTitle Idiopathic disseminated bacillus calmette-guérin
RefTitle infection: a french national retrospective study.
RefLoc Pediatrics 98:774-778 (1996)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0042: 19719
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0042: 988
Feature /codon: cgc -> tgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P38484; INGR2_HUMAN: 114
Feature /change: R -> C
Feature /domain: EC
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0042: 19719
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0042: 988
Feature /codon: cgc -> tgc; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P38484; INGR2_HUMAN: 114
Feature /change: R -> C
Feature /domain: EC
Symptoms BCG vaccination:
Symptoms BCG vaccinated: Yes; infected by BCG: Yes
Symptoms Mycobacterial infections:
Symptoms Mycobacterium bovis; skin, soft tissue, bones
Symptoms M. abscessus
Symptoms Other clinical features: cellulitis, adenitis of the neck,
Symptoms with disseminated skin vasculitis, wasting, fever,
Symptoms leukocytosis
Diagnosis Partial IFN-gamma receptor-2 deficiency
Age 1,5 months
Sex XX
Ethnic origin Caucasoid; France
Parents Consanguineous
//
ID T168N(1),T168N(1); standard; MUTATION; EC,EC
Accession I0006
Systematic name Allele 1 and 2: g.25080C>A, c.503C>A, r.503c>a, p.Thr168Asn
Original code P2
Description Allele 1 and 2: a point mutation in the exon 4 leading to
Description an amino acid change in the EC domain
Date 10-Aug-2005 (Rel. 1, Created)
Date 10-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15924140
RefAuthors Vogt, G., Chapgier, A., Yang, K., Chuzhanova, N.,
RefAuthors Feinberg, J., Fieschi, C., Boisson-Dupuis, S., Alcais, A.,
RefAuthors Filipe-Santos, O., Bustamante, J., de Beaucoudrey, L., Al-
RefAuthors Mohsen, I., Al-Hajjar, S., Al-Ghonaium, A., Adimi, P.,
RefAuthors Mirsaeidi, M., Khalilzadeh, S., Rosenzweig, S., de la
RefAuthors Calle Martin, O., Bauer, T. R., Puck, J. M., Ochs, H. D.,
RefAuthors Furthner, D., Engelhorn, C., Belohradsky, B., Mansouri,
RefAuthors D., Holland, S. M., Schreiber, R. D., Abel, L., Cooper, D.
RefAuthors N., Soudais, C., Casanova, J. L.
RefTitle Gains of glycosylation comprise an unexpectedly large
RefTitle group of pathogenic mutations.
RefLoc Nat Genet 37:692-700 (2005)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0042: 25080
Feature /change: c -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0042: 1151
Feature /codon: acc -> aac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P38484; INGR2_HUMAN: 168
Feature /change: T -> N
Feature /domain: EC
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0042: 25080
Feature /change: c -> a
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0042: 1151
Feature /codon: acc -> aac; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P38484; INGR2_HUMAN: 168
Feature /change: T -> N
Feature /domain: EC
Symptoms BCG vaccination:
Symptoms BCG vaccinated: Yes; infected by BCG: Yes
Diagnosis Complete IFN-gamma receptor-2 deficiency
Sex XY
Ethnic origin Caucasoid; Iran
Parents Consanguineous
//
ID T168N(2a),T168N(2a); standard; MUTATION; EC,EC
Accession I0007
Systematic name Allele 1 and 2: g.25080C>A, c.503C>A, r.503c>a, p.Thr168Asn
Original code P3
Description Allele 1 and 2: a point mutation in the exon 4 leading to
Description an amino acid change in the EC domain
Date 10-Aug-2005 (Rel. 1, Created)
Date 10-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15924140
RefAuthors Vogt, G., Chapgier, A., Yang, K., Chuzhanova, N.,
RefAuthors Feinberg, J., Fieschi, C., Boisson-Dupuis, S., Alcais, A.,
RefAuthors Filipe-Santos, O., Bustamante, J., de Beaucoudrey, L., Al-
RefAuthors Mohsen, I., Al-Hajjar, S., Al-Ghonaium, A., Adimi, P.,
RefAuthors Mirsaeidi, M., Khalilzadeh, S., Rosenzweig, S., de la
RefAuthors Calle Martin, O., Bauer, T. R., Puck, J. M., Ochs, H. D.,
RefAuthors Furthner, D., Engelhorn, C., Belohradsky, B., Mansouri,
RefAuthors D., Holland, S. M., Schreiber, R. D., Abel, L., Cooper, D.
RefAuthors N., Soudais, C., Casanova, J. L.
RefTitle Gains of glycosylation comprise an unexpectedly large
RefTitle group of pathogenic mutations.
RefLoc Nat Genet 37:692-700 (2005)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0042: 25080
Feature /change: c -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0042: 1151
Feature /codon: acc -> aac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P38484; INGR2_HUMAN: 168
Feature /change: T -> N
Feature /domain: EC
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0042: 25080
Feature /change: c -> a
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0042: 1151
Feature /codon: acc -> aac; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P38484; INGR2_HUMAN: 168
Feature /change: T -> N
Feature /domain: EC
Symptoms Mycobacterial infections:
Symptoms M. fortuitum; disseminated disease
Symptoms Other clinical features: cytomegalovirus
Diagnosis Complete IFN-gamma receptor-2 deficiency
Sex XY
Ethnic origin Caucasoid; Saudi-Arabia
Parents Consanguineous
Relative IFNGR2base; I0008 brother
Comment Patient died at 6 years of age
//
ID T168N(2b),T168N(2b); standard; MUTATION; EC,EC
Accession I0008
Systematic name Allele 1 and 2: g.25080C>A, c.503C>A, r.503c>a, p.Thr168Asn
Original code P4
Description Allele 1 and 2: a point mutation in the exon 4 leading to
Description an amino acid change in the EC domain
Date 10-Aug-2005 (Rel. 1, Created)
Date 10-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15924140
RefAuthors Vogt, G., Chapgier, A., Yang, K., Chuzhanova, N.,
RefAuthors Feinberg, J., Fieschi, C., Boisson-Dupuis, S., Alcais, A.,
RefAuthors Filipe-Santos, O., Bustamante, J., de Beaucoudrey, L., Al-
RefAuthors Mohsen, I., Al-Hajjar, S., Al-Ghonaium, A., Adimi, P.,
RefAuthors Mirsaeidi, M., Khalilzadeh, S., Rosenzweig, S., de la
RefAuthors Calle Martin, O., Bauer, T. R., Puck, J. M., Ochs, H. D.,
RefAuthors Furthner, D., Engelhorn, C., Belohradsky, B., Mansouri,
RefAuthors D., Holland, S. M., Schreiber, R. D., Abel, L., Cooper, D.
RefAuthors N., Soudais, C., Casanova, J. L.
RefTitle Gains of glycosylation comprise an unexpectedly large
RefTitle group of pathogenic mutations.
RefLoc Nat Genet 37:692-700 (2005)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0042: 25080
Feature /change: c -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0042: 1151
Feature /codon: acc -> aac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P38484; INGR2_HUMAN: 168
Feature /change: T -> N
Feature /domain: EC
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0042: 25080
Feature /change: c -> a
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0042: 1151
Feature /codon: acc -> aac; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P38484; INGR2_HUMAN: 168
Feature /change: T -> N
Feature /domain: EC
Symptoms Mycobacterial infections:
Symptoms M. fortuitum; disseminated disease
Symptoms Other clinical features: cytomegalovirus
Diagnosis Complete IFN-gamma receptor-2 deficiency
Sex XY
Ethnic origin Caucasoid; Saudi-Arabia
Parents Consanguineous
Relative IFNGR2base; I0007 brother
//
ID #S221-9(1),#S221-9(1); standard; MUTATION; EC,EC
Accession I0005
Systematic name Allele 1 and 2:
Systematic name g.30384_30410delTAACATCTTTAGAGTCGGGCATTTAAG,
Systematic name c.663_689delTAACATCTTTAGAGTCGGGCATTTAAG,
Systematic name r.663_689deluaacaucuuuagagucgggcauuuaag, p.Ser221del
Original code P1
Description Allele 1 and 2: an inframe deletion in the exon 5 leading
Description to an amino acid change in the EC domain
Date 10-Aug-2005 (Rel. 1, Created)
Date 10-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15924140
RefAuthors Vogt, G., Chapgier, A., Yang, K., Chuzhanova, N.,
RefAuthors Feinberg, J., Fieschi, C., Boisson-Dupuis, S., Alcais, A.,
RefAuthors Filipe-Santos, O., Bustamante, J., de Beaucoudrey, L., Al-
RefAuthors Mohsen, I., Al-Hajjar, S., Al-Ghonaium, A., Adimi, P.,
RefAuthors Mirsaeidi, M., Khalilzadeh, S., Rosenzweig, S., de la
RefAuthors Calle Martin, O., Bauer, T. R., Puck, J. M., Ochs, H. D.,
RefAuthors Furthner, D., Engelhorn, C., Belohradsky, B., Mansouri,
RefAuthors D., Holland, S. M., Schreiber, R. D., Abel, L., Cooper, D.
RefAuthors N., Soudais, C., Casanova, J. L.
RefTitle Gains of glycosylation comprise an unexpectedly large
RefTitle group of pathogenic mutations.
RefLoc Nat Genet 37:692-700 (2005)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0042: 30384..30410
Feature /change: -taacatcttt agagtcgggc atttaag
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0042: 1311..1337
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P38484; INGR2_HUMAN: 221..230
Feature /change: SNIFRVGHLS -> S
Feature /domain: EC
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0042: 30384..30410
Feature /change: -taacatcttt agagtcgggc atttaag
Feature /genomic_region: exon; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0042: 1311..1337
Feature aa; 6
Feature /rnalink: 5
Feature /name: deletion; inframe
Feature /loc: UniProt: P38484; INGR2_HUMAN: 221..230
Feature /change: SNIFRVGHLS -> S
Feature /domain: EC
Symptoms Mycobacterial infections:
Symptoms M. avium complex (MAC)
Diagnosis Complete IFN-gamma receptor-2 deficiency
Sex XY
Ethnic origin Caucasoid; Austria
Parents Consanguineous
//
ID #G264X271(1a),#G264X271(1a); standard; MUTATION; TM,TM
Accession I0003
Systematic name Allele 1 and 2: g.30889delG, c.791delG, r.791delg,
Systematic name p.Gly264fsX8
Original code Patient 1
Description Allele 1 and 2: a frame shift deletion mutation in the exon
Description 6 leading to a premature stop codon in the TM domain
Date 22-Sep-2004 (Rel. 1, Created)
Date 22-Sep-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15356149
RefAuthors Rosenzweig, S. D., Dorman, S. E., Uzel, G., Shaw, S.,
RefAuthors Scurlock, A., Brown, M. R., Buckley, R. H., Holland, S. M.
RefTitle A novel mutation in IFN-gamma receptor 2 with dominant
RefTitle negative activity: biological consequences of homozygous
RefTitle and heterozygous states.
RefLoc J Immunol 173:4000-4008 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0042: 30889
Feature /change: -g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0042: 1439
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P38484; INGR2_HUMAN: 264
Feature /change: G -> EPVSSWSX
Feature /domain: TM
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0042: 30889
Feature /change: -g
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0042: 1439
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P38484; INGR2_HUMAN: 264
Feature /change: G -> EPVSSWSX
Feature /domain: TM
Symptoms BCG vaccination:
Symptoms BCG vaccinated: Yes; infected by BCG: Yes; infection:
Symptoms fever, generalized rash, left axillary lymphadenopathy and
Symptoms hepatosplenomegaly
Symptoms Mycobacterial infections:
Symptoms M. abscessus; multifocal osteomyelitis; right remur, right
Symptoms tibia, and mandible
Diagnosis Complete IFN-gamma receptor-2 deficiency
Sex XX
Ethnic origin Qatari
Parents Consanguineous
Treatment Bone marrow transplantation: Yes
Treatment Outcome
Treatment BMT-related problems: acute GvHD grade >3
Relative IFNGR2base; I0004 brother
Comment Two months after BMT patient developed fulminant
Comment catheter-associated Serratia marcescens septicemia and
Comment died.
//
ID #G264X271(1b),#G264X271(1b); standard; MUTATION; TM,TM
Accession I0004
Systematic name Allele 1 and 2: g.30889delG, c.791delG, r.791delg,
Systematic name p.Gly264fsX8
Original code Patient 2
Description Allele 1 and 2: a frame shift deletion mutation in the exon
Description 6 leading to a premature stop codon in the TM domain
Date 22-Sep-2004 (Rel. 1, Created)
Date 22-Sep-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15356149
RefAuthors Rosenzweig, S. D., Dorman, S. E., Uzel, G., Shaw, S.,
RefAuthors Scurlock, A., Brown, M. R., Buckley, R. H., Holland, S. M.
RefTitle A novel mutation in IFN-gamma receptor 2 with dominant
RefTitle negative activity: biological consequences of homozygous
RefTitle and heterozygous states.
RefLoc J Immunol 173:4000-4008 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0042: 30889
Feature /change: -g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0042: 1439
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P38484; INGR2_HUMAN: 264
Feature /change: G -> EPVSSWSX
Feature /domain: TM
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0042: 30889
Feature /change: -g
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0042: 1439
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P38484; INGR2_HUMAN: 264
Feature /change: G -> EPVSSWSX
Feature /domain: TM
Symptoms BCG vaccination:
Symptoms BCG vaccinated: No
Symptoms Mycobacterial infections:
Symptoms M. avium complex (MAC); numerous splenic and cerebral
Symptoms abscesses
Symptoms Other clinical features: glucose-6-phosphate dehydrogenase
Symptoms deficiency, thalassemia major, viral exanthem, oral
Symptoms candidiasis, hepatosplenomegaly, rash, coagulopathy, CMV
Diagnosis Complete IFN-gamma receptor-2 deficiency
Sex XY
Ethnic origin Qatari
Parents Consanguineous
Treatment Bone marrow transplantation: Yes
Relative IFNGR2base; I0003 sister
//
|
