Database FOXP3base
Version 1.1
File foxp3pub.txt
Date 08-Apr-2013
Curator Mauno Vihinen
Address Protein Structure and Bioinformatics
Address Lund University, BMC D10, SE-22184 Lund, Sweden
Phone +46 72 526 0022
Fax +46 46 222 9328
Email Mauno Vihinen
URL http://structure.bmc.lu.se/idbase/FOXP3base/
IDR factfile http://structure.bmc.lu.se/idbase/IDRefSeq/xml/idr/ff/FF78.html
Gene FOXP3
Disease IPEX syndrome
OMIM 300292
GDB 10796361
Sequence IDRefSeq:D0035; IDRefSeq:C0035; UniProt:Q9BZS1
Numbering start of the entry
Funding Tampere University Hospital Medical Research Fund
Funding European Union
Comments sequence entry reference in every entry
//
ID &F373(1); standard; MUTATION;
Accession F0013
Systematic name g., c., r., p.Phe373Ala
Original code P1
Description A complex mutation in the exon 11 leading to an amino acid
Description change
Date 08-May-2008 (Rel. 1, Created)
Date 08-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16741580
RefAuthors Bacchetta, R., Passerini, L., Gambineri, E., Dai, M.,
RefAuthors Allan, S. E., Perroni, L., Dagna-Bricarelli, F.,
RefAuthors Sartirana, C., Matthes-Martin, S., Lawitschka, A., Azzari,
RefAuthors C., Ziegler, S. F., Levings, M. K., Roncarolo, M. G.
RefTitle Defective regulatory and effector T cell functions in
RefTitle patients with FOXP3 mutations.
RefLoc J Clin Invest:1713-1722 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: complex
Feature /loc: IDRefSeq: D0035: 81684..81685
Feature /change: tt -> gc
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 1305..1306
Feature /codon: ttc -> gcc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 373
Feature /change: F -> A
Age 0
Sex XY
Family history Inherited
Symptoms Diabetes mellitus
Symptoms Age of onset: 0
Treatment Bone marrow transplantation: Yes
//
ID M1I(1); standard; MUTATION;
Accession F0015
Systematic name g.74878G>A, c.3G>A, r.3g>a, p.Met1Ile
Original code P3 ref.[1]; P.2 ref.[2]
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 09-May-2008 (Rel. 1, Created)
Date 22-Jul-2010 (Rel. 1, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 16741580
RefAuthors Bacchetta, R., Passerini, L., Gambineri, E., Dai, M.,
RefAuthors Allan, S. E., Perroni, L., Dagna-Bricarelli, F.,
RefAuthors Sartirana, C., Matthes-Martin, S., Lawitschka, A., Azzari,
RefAuthors C., Ziegler, S. F., Levings, M. K., Roncarolo, M. G.
RefTitle Defective regulatory and effector T cell functions in
RefTitle patients with FOXP3 mutations.
RefLoc J Clin Invest:1713-1722 (2006)
RefNumber [2]
RefCrossRef PUBMED; 18951619
RefAuthors Gambineri, E., Perroni, L., Passerini, L., Bianchi, L.,
RefAuthors Doglioni, C., Meschi, F., Bonfanti, R., Sznajer, Y.,
RefAuthors Tommasini, A., Lawitschka, A., Junker, A., Dunstheimer,
RefAuthors D., Heidemann, P. H., Cazzola, G., Cipolli, M., Friedrich,
RefAuthors W., Janic, D., Azzi, N., Richmond, E., Vignola, S.,
RefAuthors Barabino, A., Chiumello, G., Azzari, C., Roncarolo, M. G.,
RefAuthors Bacchetta, R.
RefTitle Clinical and molecular profile of a new series of patients
RefTitle with immune dysregulation, polyendocrinopathy,
RefTitle enteropathy, X-linked syndrome: inconsistent correlation
RefTitle between forkhead box protein 3 expression and disease
RefTitle severity.
RefLoc J Allergy Clin Immunol:1105-1112.e1 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 74878
Feature /change: g -> a
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 191
Feature /codon: atg -> ata; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 1
Feature /change: M -> I
Age 0
Sex XY
Symptoms Ketoacidosis
Symptoms Hypothyroidism
Symptoms Enteropathy; Severe diarrhea, villous atrophy
Symptoms Skin disease
Symptoms Eczema: severe
Symptoms Lymphoadenopathy;
Symptoms Hepatosplenomegaly;
Treatment Immunosuppressive therapy:
Treatment Cyclosporin A:
Treatment Methylprednisolone
Treatment Bone marrow transplantation: Yes
Treatment Donor: MUD
IgE 28,800 UI/mL, compare with normal for age: high
Response Antibodies
Response anti-islet cells
Response anti-insulin antibody
//
ID M1T(1); standard; MUTATION;
Accession F0036
Systematic name g.74877T>C, c.2T>C, r.2u>c, p.Met1Thr
Original code P.1
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 22-Jul-2010 (Rel. 1, Created)
Date 22-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18951619
RefAuthors Gambineri, E., Perroni, L., Passerini, L., Bianchi, L.,
RefAuthors Doglioni, C., Meschi, F., Bonfanti, R., Sznajer, Y.,
RefAuthors Tommasini, A., Lawitschka, A., Junker, A., Dunstheimer,
RefAuthors D., Heidemann, P. H., Cazzola, G., Cipolli, M., Friedrich,
RefAuthors W., Janic, D., Azzi, N., Richmond, E., Vignola, S.,
RefAuthors Barabino, A., Chiumello, G., Azzari, C., Roncarolo, M. G.,
RefAuthors Bacchetta, R.
RefTitle Clinical and molecular profile of a new series of patients
RefTitle with immune dysregulation, polyendocrinopathy,
RefTitle enteropathy, X-linked syndrome: inconsistent correlation
RefTitle between forkhead box protein 3 expression and disease
RefTitle severity.
RefLoc J Allergy Clin Immunol:1105-1112.e1 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 74877
Feature /change: t -> c
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 190
Feature /codon: atg -> acg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 1
Feature /change: M -> T
Age 0
Sex XY
Symptoms Hyperglycemic
Symptoms Enteropathy: Severe diarrhea, villous atrophy
Symptoms Infections:
Symptoms Bacterial: sepsis
Treatment IVIG
Treatment Immunosuppressive therapy:
Treatment Cyclosporin A:
Treatment FK506:
IgE 3910 UI/mL, compare with normal for age: high
Response Antibody responses
Response anti-enterocyte antibody
Comment Patient died at age 3 months.
//
ID #L76X128(1); standard; MUTATION;
Accession F0007
Systematic name g.75629delT, c.227delT, r.227delu, p.Leu76fsX53
Original code Patient 1
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 21-Sep-2004 (Rel. 3, Created)
Date 21-Sep-2004 (Rel. 3, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11768393
RefAuthors Kobayashi, I., Shiari, R., Yamada, M., Kawamura, N.,
RefAuthors Okano, M., Yara, A., Iguchi, A., Ishikawa, N., Ariga, T.,
RefAuthors Sakiyama, Y., Ochs, H. D., Kobayashi, K.
RefTitle Novel mutations of FOXP3 in two japanese patients with
RefTitle immune dysregulation, polyendocrinopathy, enteropathy, X
RefTitle linked syndrome (IPEX).
RefLoc J Med Genet 38:874-876 (2001)
RefNumber [2]
RefCrossRef PUBMED; 9528893
RefAuthors Kobayashi, I., Imamura, K., Yamada, M., Okano, M., Yara,
RefAuthors A., Ikema, S., Ishikawa, N.
RefTitle A 75-kD autoantigen recognized by sera from patients with
RefTitle X-linked autoimmune enteropathy associated with
RefTitle nephropathy.
RefLoc Clin Exp Immunol 111:527-531 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0035: 75629
Feature /change: -t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0035: 415
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9BZS1; FOXP3_HUMAN: 76
Feature /change: L ->
Feature /change: QSWWHPPGHG WAPCPTYRHS SRTGHISCTS SQRWMPTPGP
Feature /change: LCCRCTPWRA QPX
Sex XY
Ethnic origin Mongoloid; Japan
Symptoms Thyroid diseases
Symptoms Other autoimmune phenomena
Symptoms Hemolytic anemia: persistent
Symptoms Other: renal tubular dysfunction
Symptoms Enteropathy: yes; watery diarrhea
//
ID #L76X128(2); standard; MUTATION;
Accession F0034
Systematic name g.75629delT, c.227delT, r.227delu, p.Leu76fsX53
Original code V
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18931102
RefAuthors Rubio-Cabezas, O., Minton, J. A., Caswell, R., Shield, J.
RefAuthors P., Deiss, D., Sumnik, Z., Cayssials, A., Herr, M., Loew,
RefAuthors A., Lewis, V., Ellard, S., Hattersley, A. T.
RefTitle Clinical heterogeneity in patients with FOXP3 mutations
RefTitle presenting with permanent neonatal diabetes.
RefLoc Diabetes Care:111-116 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0035: 75629
Feature /change: -t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 415
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 76
Feature /change: L ->
Feature /change: QSWWHPPGHG WAPCPTYRHS SRTGHISCTS SQRWMPTPGP
Feature /change: LCCRCTPWRA QPX
Age 0
Sex XY
Ethnic origin England
Symptoms Diabetes mellitus
Symptoms Age of onset: 1 day
Symptoms Watery diarrhoea; Anemia; Neutropenia; Sepsis;
Symptoms Thrombocytopenia; Thyroid dysfunction; Recurrent
Symptoms respiratory tract infection;
Comment Patient died at age of 8 months.
//
ID #H101X204(1); standard; MUTATION;
Accession F0016
Systematic name g.75705_75706delTT, c.303_304delTT, r.303_304deluu,
Systematic name p.Phe102fsX103
Original code patient
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon
Date 21-May-2008 (Rel. 1, Created)
Date 21-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17629750
RefAuthors Moudgil, A., Perriello, P., Loechelt, B., Przygodzki, R.,
RefAuthors Fitzerald, W., Kamani, N.
RefTitle Immunodysregulation, polyendocrinopathy, enteropathy, X-
RefTitle linked (IPEX) syndrome: an unusual cause of proteinuria in
RefTitle infancy.
RefLoc Pediatr Nephrol:1799-1802 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0035: 75705..75706
Feature /change: -tt
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 491..492
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 101..102
Feature /change: HF ->
Feature /change: HHAPALNGGC PRPDPCAAGA PPGEPSHDQP HTTHHRHWGL
Feature /change: LPQGPAWPPT WDQRGQPGMG VQGAGTALHL PKSQCTQEGQ
Feature /change: HPFGCAPELL PTAGKWCLQV ARMX
Age 0,4
Sex XY
Ethnic origin Negroid; USA
Symptoms Diabetes mellitus
Symptoms Thyroid diseases
Symptoms Hypothyroidism: present
Symptoms Growth delay/Failure to thrive
Symptoms Enteropathy: yes;
Symptoms Skin disease
Symptoms Excema: yes
Symptoms Alopecia: yes
//
ID S181S(1); standard; MUTATION;
Accession F0038
Systematic name g.76526C>T, c.543C>T, r.543c>u, p.Ser181Ser
Original code P.4
Description A point mutation in the exon 6 leading to an amino acid
Description change
Date 22-Jul-2010 (Rel. 1, Created)
Date 22-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18951619
RefAuthors Gambineri, E., Perroni, L., Passerini, L., Bianchi, L.,
RefAuthors Doglioni, C., Meschi, F., Bonfanti, R., Sznajer, Y.,
RefAuthors Tommasini, A., Lawitschka, A., Junker, A., Dunstheimer,
RefAuthors D., Heidemann, P. H., Cazzola, G., Cipolli, M., Friedrich,
RefAuthors W., Janic, D., Azzi, N., Richmond, E., Vignola, S.,
RefAuthors Barabino, A., Chiumello, G., Azzari, C., Roncarolo, M. G.,
RefAuthors Bacchetta, R.
RefTitle Clinical and molecular profile of a new series of patients
RefTitle with immune dysregulation, polyendocrinopathy,
RefTitle enteropathy, X-linked syndrome: inconsistent correlation
RefTitle between forkhead box protein 3 expression and disease
RefTitle severity.
RefLoc J Allergy Clin Immunol:1105-1112.e1 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 76526
Feature /change: c -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 731
Feature /codon: agc -> agt; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 181
Feature /change: S -> S
Sex XY
Deceased Age at death: 5 mo
Symptoms Enteropathy: Severe diarrhea
Treatment IVIG
Treatment Immunosuppressive therapy:
Treatment Cyclosporin A
Treatment Methylprednisolone
IgE 3 UI/mL
//
ID S181S/F324L(1); standard; MUTATION;
Accession F0039
Systematic name g.[76526C>T/80177T>C], c.[543C>T/970T>C],
Systematic name r.[543c>u/970u>c], p.[Ser181Ser/Phe324Leu]
Original code P.5
Description A point mutation in the exon 6 leading to an amino acid
Description change
Date 22-Jul-2010 (Rel. 1, Created)
Date 22-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18951619
RefAuthors Gambineri, E., Perroni, L., Passerini, L., Bianchi, L.,
RefAuthors Doglioni, C., Meschi, F., Bonfanti, R., Sznajer, Y.,
RefAuthors Tommasini, A., Lawitschka, A., Junker, A., Dunstheimer,
RefAuthors D., Heidemann, P. H., Cazzola, G., Cipolli, M., Friedrich,
RefAuthors W., Janic, D., Azzi, N., Richmond, E., Vignola, S.,
RefAuthors Barabino, A., Chiumello, G., Azzari, C., Roncarolo, M. G.,
RefAuthors Bacchetta, R.
RefTitle Clinical and molecular profile of a new series of patients
RefTitle with immune dysregulation, polyendocrinopathy,
RefTitle enteropathy, X-linked syndrome: inconsistent correlation
RefTitle between forkhead box protein 3 expression and disease
RefTitle severity.
RefLoc J Allergy Clin Immunol:1105-1112.e1 (2008)
Feature dna; 1
Feature /rnalink: 3
Feature /name: point
Feature /loc: IDRefSeq: D0035: 76526
Feature /change: c -> t
Feature /genomic_region: exon; 6
Feature dna; 2
Feature /rnalink: 4
Feature /name: point
Feature /loc: IDRefSeq: D0035: 80177
Feature /change: t -> c
Feature /genomic_region: exon; 10
Feature rna; 3
Feature /dnalink: 1
Feature /aalink: 5
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 731
Feature /codon: agc -> agt; 3
Feature rna; 4
Feature /dnalink: 2
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 1158
Feature /codon: ttc -> ctc; 1
Feature aa; 5
Feature /rnalink: 3
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 181
Feature /change: S -> S
Feature aa; 6
Feature /rnalink: 4
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 324
Feature /change: F -> L
Sex XY
Symptoms Severe diarrhea
Symptoms Eczema: Mild
Symptoms Allergic asthma
IgE 374 UI/mL
//
ID P187L(1); standard; MUTATION;
Accession F0026
Systematic name g.76543C>T, c.560C>T, r.560c>u, p.Pro187Leu
Original code P.4
Description A point mutation in the exon 6 leading to an amino acid
Description change
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18795917
RefAuthors Halabi-Tawil, M., Ruemmele, F. M., Fraitag, S., Rieux-
RefAuthors Laucat, F., Neven, B., Brousse, N., De Prost, Y., Fischer,
RefAuthors A., Goulet, O., Bodemer, C.
RefTitle Cutaneous manifestations of immune dysregulation,
RefTitle polyendocrinopathy, enteropathy, X-linked (IPEX) syndrome.
RefLoc Br J Dermatol:645-651 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 76543
Feature /change: c -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 748
Feature /codon: ccc -> ctc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 187
Feature /change: P -> L
Sex XY
Symptoms Diabetes mellitus; Skin lesions; Diarrhoea; Cytopenia;
Symptoms Thyroid diseases; Pneumonia; Atopic dermatitis;
Symptoms Failure to thrive; Psoriasiform; Eczema;
Symptoms Perioral oedema; Cheilits;
//
ID L242P(1); standard; MUTATION;
Accession F0046
Systematic name g.77652T>C, c.725T>C, r.725u>c, p.Leu242Pro
Original code P.14
Description A point mutation in the exon 7 leading to an amino acid
Description change
Date 22-Jul-2010 (Rel. 1, Created)
Date 22-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18951619
RefAuthors Gambineri, E., Perroni, L., Passerini, L., Bianchi, L.,
RefAuthors Doglioni, C., Meschi, F., Bonfanti, R., Sznajer, Y.,
RefAuthors Tommasini, A., Lawitschka, A., Junker, A., Dunstheimer,
RefAuthors D., Heidemann, P. H., Cazzola, G., Cipolli, M., Friedrich,
RefAuthors W., Janic, D., Azzi, N., Richmond, E., Vignola, S.,
RefAuthors Barabino, A., Chiumello, G., Azzari, C., Roncarolo, M. G.,
RefAuthors Bacchetta, R.
RefTitle Clinical and molecular profile of a new series of patients
RefTitle with immune dysregulation, polyendocrinopathy,
RefTitle enteropathy, X-linked syndrome: inconsistent correlation
RefTitle between forkhead box protein 3 expression and disease
RefTitle severity.
RefLoc J Allergy Clin Immunol:1105-1112.e1 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 77652
Feature /change: t -> c
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 913
Feature /codon: ctg -> ccg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 242
Feature /change: L -> P
Sex XY
Symptoms Severe diarrhoea; Villous atrophy; Mild eczema;
Symptoms Sepsis nephropathy;
Treatment Immunosuppressive therapy:
Treatment Cyclosporin A:
Treatment Methylprednisolone
Treatment FK506
Treatment Prednisone
IgE 5218 UI/mL
Response Antibody responses
Response anti-enterocyte antibody
//
ID #K250-1(1); standard; MUTATION;
Accession F0010
Systematic name g.77880_77882delAAG, c.748_750delAAG, r.748_750delaag,
Systematic name p.Lys250del
Original code Case 3
Description An inframe deletion in the exon 8 leading to an amino acid
Description change
Date 22-Sep-2004 (Rel. 3, Created)
Date 22-Sep-2004 (Rel. 3, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12161590
RefAuthors Wildin, R. S., Smyk-Pearson, S., Filipovich, A. H.
RefTitle Clinical and molecular features of the
RefTitle immunodysregulation, polyendocrinopathy, enteropathy, X
RefTitle linked (IPEX) syndrome.
RefLoc J Med Genet 39:537-545 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0035: 77880..77882
Feature /change: -aag
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0035: 936..938
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: Q9BZS1; FOXP3_HUMAN: 250
Feature /change: -K
Sex XY
Deceased Cause of death: respiratory distress through to result from
Deceased infection and fluid overload on post-BMT day 94
Symptoms Diabetes mellitus
Symptoms Other autoimmune phenomena
Symptoms Other: chronic idiopathic thrombocytopenic purpura
Symptoms Infections:
Symptoms Viral: CMV
Treatment Bone marrow transplantation: Yes
Treatment Donor: MUD
//
ID #K250-1(2); standard; MUTATION;
Accession F0047
Systematic name g.77880_77882delAAG, c.748_750delAAG, r.748_750delaag,
Systematic name p.Lys250del
Description An inframe deletion in the exon 8 leading to an amino acid
Description change
Date 22-Jul-2010 (Rel. 1, Created)
Date 22-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 19189134
RefAuthors Hashimura, Y., Nozu, K., Kanegane, H., Miyawaki, T.,
RefAuthors Hayakawa, A., Yoshikawa, N., Nakanishi, K., Takemoto, M.,
RefAuthors Iijima, K., Matsuo, M.
RefTitle Minimal change nephrotic syndrome associated with immune
RefTitle dysregulation, polyendocrinopathy, enteropathy, X-linked
RefTitle syndrome.
RefLoc Pediatr Nephrol:1181-1186 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0035: 77880..77882
Feature /change: -aag
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 936..938
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 250
Feature /change: -K
Age 2 mo
Sex XY
Ethnic origin Japan
Symptoms Polyposia; Polyuria; Nephrotic syndrome;
Symptoms Glomerular abnormalities; Vomiting;
Symptoms Failure to thrive; Hyperglycemia;
Symptoms Infections:
Symptoms Bacterial: sepsis
Treatment Immunosuppressive therapy:
Treatment Cyclosporin
IgE 1141 IU/mL, compare with normal for age: high
//
ID #E251-1(1); standard; MUTATION;
Accession F0028
Systematic name g.77883_77885delGAG, c.751_753delGAG, r.751_753delgag,
Systematic name p.Glu251del
Original code P.8
Description An inframe deletion in the exon 8 leading to an amino acid
Description change
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18795917
RefAuthors Halabi-Tawil, M., Ruemmele, F. M., Fraitag, S., Rieux-
RefAuthors Laucat, F., Neven, B., Brousse, N., De Prost, Y., Fischer,
RefAuthors A., Goulet, O., Bodemer, C.
RefTitle Cutaneous manifestations of immune dysregulation,
RefTitle polyendocrinopathy, enteropathy, X-linked (IPEX) syndrome.
RefLoc Br J Dermatol:645-651 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0035: 77883..77885
Feature /change: -gag
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 939..941
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 251
Feature /change: -E
Sex XY
Symptoms Diabetes mellitus; Diarrhoea; Cytopenia; Pneumonia;
Symptoms Thyroid diseases; Hepatosplenomegaly;
Symptoms Failure to thrive;
//
ID #E251-1(2); standard; MUTATION;
Accession F0029
Systematic name g.77883_77885delGAG, c.751_753delGAG, r.751_753delgag,
Systematic name p.Glu251del
Original code P.9
Description An inframe deletion in the exon 8 leading to an amino acid
Description change
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18795917
RefAuthors Halabi-Tawil, M., Ruemmele, F. M., Fraitag, S., Rieux-
RefAuthors Laucat, F., Neven, B., Brousse, N., De Prost, Y., Fischer,
RefAuthors A., Goulet, O., Bodemer, C.
RefTitle Cutaneous manifestations of immune dysregulation,
RefTitle polyendocrinopathy, enteropathy, X-linked (IPEX) syndrome.
RefLoc Br J Dermatol:645-651 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0035: 77883..77885
Feature /change: -gag
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 939..941
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 251
Feature /change: -E
Sex XY
Symptoms Diabetes mellitus; Diarrhoea; Cytopenia; Pneumonia;
Symptoms Thyroid diseases; Hepatosplenomegaly;
Symptoms Failure to thrive;
//
ID F324L(1); standard; MUTATION;
Accession F0014
Systematic name g.80177T>C, c.970T>C, r.970u>c, p.Phe324Leu
Original code P2
Description A point mutation in the exon 10 leading to an amino acid
Description change
Date 09-May-2008 (Rel. 1, Created)
Date 09-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16741580
RefAuthors Bacchetta, R., Passerini, L., Gambineri, E., Dai, M.,
RefAuthors Allan, S. E., Perroni, L., Dagna-Bricarelli, F.,
RefAuthors Sartirana, C., Matthes-Martin, S., Lawitschka, A., Azzari,
RefAuthors C., Ziegler, S. F., Levings, M. K., Roncarolo, M. G.
RefTitle Defective regulatory and effector T cell functions in
RefTitle patients with FOXP3 mutations.
RefLoc J Clin Invest:1713-1722 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 80177
Feature /change: t -> c
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 1158
Feature /codon: ttc -> ctc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 324
Feature /change: F -> L
Age 0,4
Sex XY
Symptoms Skin disease
Symptoms Excema: yes
//
ID R337Q(1); standard; MUTATION;
Accession F0033
Systematic name g.80217G>A, c.1010G>A, r.1010g>a, p.Arg337Gln
Original code III
Description A point mutation in the exon 10 leading to an amino acid
Description change
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18931102
RefAuthors Rubio-Cabezas, O., Minton, J. A., Caswell, R., Shield, J.
RefAuthors P., Deiss, D., Sumnik, Z., Cayssials, A., Herr, M., Loew,
RefAuthors A., Lewis, V., Ellard, S., Hattersley, A. T.
RefTitle Clinical heterogeneity in patients with FOXP3 mutations
RefTitle presenting with permanent neonatal diabetes.
RefLoc Diabetes Care:111-116 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 80217
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 1198
Feature /codon: cga -> caa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 337
Feature /change: R -> Q
Age 0
Sex XY
Ethnic origin Argentina
Symptoms Diabetes mellitus
Symptoms Age of onset: 30 days
Symptoms Enteropathy: yes; villous atrophy
Symptoms Infections:
Symptoms Fungal: candida
IgE 2,266 units/ml
Comment Patient died at age of 13 months.
//
ID P339A(1); standard; MUTATION;
Accession F0035
Systematic name g.80222C>G, c.1015C>G, r.1015c>g, p.Pro339Ala
Original code IV
Description A point mutation in the exon 10 leading to an amino acid
Description change
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18931102
RefAuthors Rubio-Cabezas, O., Minton, J. A., Caswell, R., Shield, J.
RefAuthors P., Deiss, D., Sumnik, Z., Cayssials, A., Herr, M., Loew,
RefAuthors A., Lewis, V., Ellard, S., Hattersley, A. T.
RefTitle Clinical heterogeneity in patients with FOXP3 mutations
RefTitle presenting with permanent neonatal diabetes.
RefLoc Diabetes Care:111-116 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 80222
Feature /change: c -> g
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 1203
Feature /codon: cct -> gct; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 339
Feature /change: P -> A
Age 0
Sex XY
Ethnic origin Germany
Symptoms Diabetes mellitus
Symptoms Age of onset: 1 week
Symptoms Maldigestion; Cholestasis; Euthyroid thyroiditis;
Symptoms Eczema;
Comment Patient died at age of 5.5 months.
//
ID R347H(1); standard; MUTATION;
Accession F0009
Systematic name g.80247G>A, c.1040G>A, r.1040g>a, p.Arg347His
Original code Case 1
Description A point mutation in the exon 10 leading to an amino acid
Description change
Date 22-Sep-2004 (Rel. 3, Created)
Date 22-Sep-2004 (Rel. 3, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12161590
RefAuthors Wildin, R. S., Smyk-Pearson, S., Filipovich, A. H.
RefTitle Clinical and molecular features of the
RefTitle immunodysregulation, polyendocrinopathy, enteropathy, X
RefTitle linked (IPEX) syndrome.
RefLoc J Med Genet 39:537-545 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 80247
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035: 1228
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FOXP3_HUMAN: 347
Feature /change: R -> H
Sex XY
Deceased Cause of death: patient developed Gram negative pneumonia
Deceased and died on day +194 post-BMT of respiratory insufficiency
Symptoms Diabetes mellitus
Symptoms Growth delay/Failure to thrive
Symptoms Enteropathy: yes;
Symptoms Infections: severe
Symptoms Bacterial: sepsis; pneumonia
Symptoms Viral: adenovirus
Treatment Bone marrow transplantation: Yes
Treatment Donor: matched sibling
//
ID R347H(2); standard; MUTATION;
Accession F0042
Systematic name g.80247G>A, c.1040G>A, r.1040g>a, p.Arg347His
Original code P.9
Description A point mutation in the exon 10 leading to an amino acid
Description change
Date 22-Jul-2010 (Rel. 1, Created)
Date 22-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18951619
RefAuthors Gambineri, E., Perroni, L., Passerini, L., Bianchi, L.,
RefAuthors Doglioni, C., Meschi, F., Bonfanti, R., Sznajer, Y.,
RefAuthors Tommasini, A., Lawitschka, A., Junker, A., Dunstheimer,
RefAuthors D., Heidemann, P. H., Cazzola, G., Cipolli, M., Friedrich,
RefAuthors W., Janic, D., Azzi, N., Richmond, E., Vignola, S.,
RefAuthors Barabino, A., Chiumello, G., Azzari, C., Roncarolo, M. G.,
RefAuthors Bacchetta, R.
RefTitle Clinical and molecular profile of a new series of patients
RefTitle with immune dysregulation, polyendocrinopathy,
RefTitle enteropathy, X-linked syndrome: inconsistent correlation
RefTitle between forkhead box protein 3 expression and disease
RefTitle severity.
RefLoc J Allergy Clin Immunol:1105-1112.e1 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 80247
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 1228
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 347
Feature /change: R -> H
Sex XY
Symptoms Hyper glycemia
Symptoms Enteropathy; Severe diarrhoea, 'Villous atrophy
Symptoms Eczema: Mild
Symptoms Hepatitis
Symptoms Thrombocytopenia
Symptoms Anaemia
Treatment Immunosuppressive therapy:
Treatment Cyclosporin A:
Treatment Prednisone
IgE 1966 UI/mL
Response Antibody responses
Response anti-glutamate decarboxylase antibody
Response anti-insulin antibody
Response anti-islet cells
Response anti-enterocyte antibody
//
ID R347H(3); standard; MUTATION;
Accession F0043
Systematic name g.80247G>A, c.1040G>A, r.1040g>a, p.Arg347His
Original code P.10
Description A point mutation in the exon 10 leading to an amino acid
Description change
Date 22-Jul-2010 (Rel. 1, Created)
Date 22-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18951619
RefAuthors Gambineri, E., Perroni, L., Passerini, L., Bianchi, L.,
RefAuthors Doglioni, C., Meschi, F., Bonfanti, R., Sznajer, Y.,
RefAuthors Tommasini, A., Lawitschka, A., Junker, A., Dunstheimer,
RefAuthors D., Heidemann, P. H., Cazzola, G., Cipolli, M., Friedrich,
RefAuthors W., Janic, D., Azzi, N., Richmond, E., Vignola, S.,
RefAuthors Barabino, A., Chiumello, G., Azzari, C., Roncarolo, M. G.,
RefAuthors Bacchetta, R.
RefTitle Clinical and molecular profile of a new series of patients
RefTitle with immune dysregulation, polyendocrinopathy,
RefTitle enteropathy, X-linked syndrome: inconsistent correlation
RefTitle between forkhead box protein 3 expression and disease
RefTitle severity.
RefLoc J Allergy Clin Immunol:1105-1112.e1 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 80247
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 1228
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 347
Feature /change: R -> H
Age <1
Sex XY
Symptoms Recurrent ear infections; Gastrectomy;
Symptoms Severe chronic gastritis; Mucosal atrophy;
Symptoms Mild xerosis; Pancreatic exocrine failure;
Treatment Immunosuppressive therapy:
Treatment Cyclosporin A:
Treatment Methylprednisolone
IgE >230 UI/mL
//
ID I363V(1); standard; MUTATION;
Accession F0008
Systematic name g.81654A>G, c.1087A>G, r.1087a>g, p.Ile363Val
Original code Patient 2
Description A point mutation in the exon 11 leading to an amino acid
Description change
Date 21-Sep-2004 (Rel. 3, Created)
Date 21-Sep-2004 (Rel. 3, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11768393
RefAuthors Kobayashi, I., Shiari, R., Yamada, M., Kawamura, N.,
RefAuthors Okano, M., Yara, A., Iguchi, A., Ishikawa, N., Ariga, T.,
RefAuthors Sakiyama, Y., Ochs, H. D., Kobayashi, K.
RefTitle Novel mutations of FOXP3 in two japanese patients with
RefTitle immune dysregulation, polyendocrinopathy, enteropathy, X
RefTitle linked syndrome (IPEX).
RefLoc J Med Genet 38:874-876 (2001)
RefNumber [2]
RefCrossRef PUBMED; 9528893
RefAuthors Kobayashi, I., Imamura, K., Yamada, M., Okano, M., Yara,
RefAuthors A., Ikema, S., Ishikawa, N.
RefTitle A 75-kD autoantigen recognized by sera from patients with
RefTitle X-linked autoimmune enteropathy associated with
RefTitle nephropathy.
RefLoc Clin Exp Immunol 111:527-531 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 81654
Feature /change: a -> g
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035: 1275
Feature /codon: atc -> gtc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FOXP3_HUMAN: 363
Feature /change: I -> V
Sex XY
Ethnic origin Mongoloid; Japan
Deceased Age at death: 3; Cause of death: sepsis
Symptoms Diabetes mellitus
Symptoms Thyroid diseases
Symptoms Other autoimmune phenomena
Symptoms Hemolytic anemia: persistent
Symptoms Other: tubulonephropathy
Symptoms Enteropathy: yes;
//
ID F367L(1); standard; MUTATION;
Accession F0020
Systematic name g.81666T>C, c.1099T>C, r.1099u>c, p.Phe367Leu
Original code P23
Description A point mutation in the exon 11 leading to an amino acid
Description change
Date 22-May-2008 (Rel. 1, Created)
Date 22-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17635943
RefAuthors Suzuki, S., Makita, Y., Mukai, T., Matsuo, K., Ueda, O.,
RefAuthors Fujieda, K.
RefTitle Molecular basis of neonatal diabetes in japanese patients.
RefLoc J Clin Endocrinol Metab:3979-3985 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 81666
Feature /change: t -> c
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 1287
Feature /codon: ttc -> ctc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 367
Feature /change: F -> L
Age 0
Sex XY
Ethnic origin Mongoloid; Japan
Deceased Age at death: 0,4
Symptoms Diabetes mellitus
Symptoms Age of onset: 0
//
ID F367L(2); standard; MUTATION;
Accession F0025
Systematic name g.81668C>G, c.1101C>G, r.1101c>g, p.Phe367Leu
Original code P.3
Description A point mutation in the exon 11 leading to an amino acid
Description change
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18795917
RefAuthors Halabi-Tawil, M., Ruemmele, F. M., Fraitag, S., Rieux-
RefAuthors Laucat, F., Neven, B., Brousse, N., De Prost, Y., Fischer,
RefAuthors A., Goulet, O., Bodemer, C.
RefTitle Cutaneous manifestations of immune dysregulation,
RefTitle polyendocrinopathy, enteropathy, X-linked (IPEX) syndrome.
RefLoc Br J Dermatol:645-651 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 81668
Feature /change: c -> g
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 1289
Feature /codon: ttc -> ttg; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 367
Feature /change: F -> L
Sex XY
Symptoms Diabetes mellitus; Skin lesions; Failure to thrive;
Symptoms Thyroid diseases; Diarrhoea; Recurrent pneumonia;
Symptoms Atopic dermatitis;
Symptoms Infections:
Symptoms Bacterial: sepsis
//
ID F371C(1); standard; MUTATION;
Accession F0024
Systematic name g.81679T>G, c.1112T>G, r.1112u>g, p.Phe371Cys
Original code P.1
Description A point mutation in the exon 11 leading to an amino acid
Description change
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18795917
RefAuthors Halabi-Tawil, M., Ruemmele, F. M., Fraitag, S., Rieux-
RefAuthors Laucat, F., Neven, B., Brousse, N., De Prost, Y., Fischer,
RefAuthors A., Goulet, O., Bodemer, C.
RefTitle Cutaneous manifestations of immune dysregulation,
RefTitle polyendocrinopathy, enteropathy, X-linked (IPEX) syndrome.
RefLoc Br J Dermatol:645-651 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 81679
Feature /change: t -> g
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 1300
Feature /codon: ttt -> tgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 371
Feature /change: F -> C
Sex XY
Symptoms Diabetes mellitus; Psoriasiform rash; Erythroderma;
Symptoms Thyroid diseases; Congenital ichthyosis; Cytopenia;
Symptoms Failure to thrive; Diarrhoea; Atopic dermatitis;
Symptoms Hepatosplenomegaly/Lymphadenopathy; Pneumonia;
Symptoms Infections:
Symptoms Bacterial: sepsis
//
ID F373V(1); standard; MUTATION;
Accession F0019
Systematic name g.81684T>G, c.1117T>G, r.1117u>g, p.Phe373Val
Original code P4
Description A point mutation in the exon 11 leading to an amino acid
Description change
Date 21-May-2008 (Rel. 1, Created)
Date 21-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17916446
RefAuthors Fuchizawa, T., Adachi, Y., Ito, Y., Higashiyama, H.,
RefAuthors Kanegane, H., Futatani, T., Kobayashi, I., Kamachi, Y.,
RefAuthors Sakamoto, T., Tsuge, I., Tanaka, H., Banham, A. H., Ochs,
RefAuthors H. D., Miyawaki, T.
RefTitle Developmental changes of FOXP3-expressing CD4+CD25+
RefTitle regulatory T cells and their impairment in patients with
RefTitle FOXP3 gene mutations.
RefLoc Clin Immunol:237-246 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 81684
Feature /change: t -> g
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 1305
Feature /codon: ttc -> gtc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 373
Feature /change: F -> V
Age 0
Sex XY
Ethnic origin Japan
Family history Inherited
Symptoms Enteropathy: yes;
//
ID F374C(1); standard; MUTATION;
Accession F0027
Systematic name g.81688T>G, c.1121T>G, r.1121u>g, p.Phe374Cys
Original code P.5
Description A point mutation in the exon 11 leading to an amino acid
Description change
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18795917
RefAuthors Halabi-Tawil, M., Ruemmele, F. M., Fraitag, S., Rieux-
RefAuthors Laucat, F., Neven, B., Brousse, N., De Prost, Y., Fischer,
RefAuthors A., Goulet, O., Bodemer, C.
RefTitle Cutaneous manifestations of immune dysregulation,
RefTitle polyendocrinopathy, enteropathy, X-linked (IPEX) syndrome.
RefLoc Br J Dermatol:645-651 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 81688
Feature /change: t -> g
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 1309
Feature /codon: ttc -> tgc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 374
Feature /change: F -> C
Sex XY
Symptoms Diabetes mellitus; Skin lesions; Diarrhoea; Cytopenia;
Symptoms Thyroid diseases; Hepatosplenomegaly; Pneumonia;
Symptoms Failure to thrive; Glomerulonephritis; Psoriasiform;
Symptoms Atopic dermatitis; Eczematiform;
Symptoms Infections:
Symptoms Bacterial: sepsis
//
ID F374C(2); standard; MUTATION;
Accession F0045
Systematic name g.81688T>G, c.1121T>G, r.1121u>g, p.Phe374Cys
Original code P.13
Description A point mutation in the exon 11 leading to an amino acid
Description change
Date 22-Jul-2010 (Rel. 1, Created)
Date 22-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18951619
RefAuthors Gambineri, E., Perroni, L., Passerini, L., Bianchi, L.,
RefAuthors Doglioni, C., Meschi, F., Bonfanti, R., Sznajer, Y.,
RefAuthors Tommasini, A., Lawitschka, A., Junker, A., Dunstheimer,
RefAuthors D., Heidemann, P. H., Cazzola, G., Cipolli, M., Friedrich,
RefAuthors W., Janic, D., Azzi, N., Richmond, E., Vignola, S.,
RefAuthors Barabino, A., Chiumello, G., Azzari, C., Roncarolo, M. G.,
RefAuthors Bacchetta, R.
RefTitle Clinical and molecular profile of a new series of patients
RefTitle with immune dysregulation, polyendocrinopathy,
RefTitle enteropathy, X-linked syndrome: inconsistent correlation
RefTitle between forkhead box protein 3 expression and disease
RefTitle severity.
RefLoc J Allergy Clin Immunol:1105-1112.e1 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 81688
Feature /change: t -> g
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 1309
Feature /codon: ttc -> tgc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 374
Feature /change: F -> C
Sex XY
Deceased Age at death: 11 mo
Symptoms Severe diarrhoea; Severe eczema; Thrombocytopenia;
Symptoms Alopecia; Autoimmune hemolytic anaemia;
Symptoms Infections:
Symptoms Viral: CMV
Treatment Immunosuppressive therapy:
Treatment Methylprednisolone
Treatment FK506
Treatment Azathioprine
IgE 7000 UI/mL
//
ID T380I(1); standard; MUTATION;
Accession F0023
Systematic name g.81706C>T, c.1139C>T, r.1139c>u, p.Thr380Ile
Description A point mutation in the exon 11 leading to an amino acid
Description change
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 81706
Feature /change: c -> t
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 1327
Feature /codon: acc -> atc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 380
Feature /change: T -> I
Age 4
Sex XY
Symptoms Chronic diarrhea; Failure to thrive; Multiple food
Symptoms allergies; Villous atrophy;
//
ID A384T(1a); standard; MUTATION;
Accession F0001
Systematic name g.81897G>A, c.1150G>A, r.1150g>a, p.Ala384Thr
Original code Family 1; V-2
Description A point mutation in the exon 12 leading to an amino acid
Description change
Date 16-Sep-2004 (Rel. 3, Created)
Date 16-Sep-2004 (Rel. 3, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11137993
RefAuthors Bennett, C. L., Christie, J., Ramsdell, F., Brunkow, M.
RefAuthors E., Ferguson, P. J., Whitesell, L., Kelly, T. E.,
RefAuthors Saulsbury, F. T., Chance, P. F., Ochs, H. D.
RefTitle The immune dysregulation, polyendocrinopathy, enteropathy,
RefTitle X-linked syndrome (IPEX) is caused by mutations of FOXP3.
RefLoc Nat Genet 27:20-21 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 81897
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035: 1338
Feature /codon: gcc -> acc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FOXP3_HUMAN: 384
Feature /change: A -> T
Sex XY
Relative FOXP3base; F0002 brother
//
ID A384T(1b); standard; MUTATION;
Accession F0002
Systematic name g.81897G>A, c.1150G>A, r.1150g>a, p.Ala384Thr
Original code Family 1; V-7
Description A point mutation in the exon 12 leading to an amino acid
Description change
Date 16-Sep-2004 (Rel. 3, Created)
Date 16-Sep-2004 (Rel. 3, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11137993
RefAuthors Bennett, C. L., Christie, J., Ramsdell, F., Brunkow, M.
RefAuthors E., Ferguson, P. J., Whitesell, L., Kelly, T. E.,
RefAuthors Saulsbury, F. T., Chance, P. F., Ochs, H. D.
RefTitle The immune dysregulation, polyendocrinopathy, enteropathy,
RefTitle X-linked syndrome (IPEX) is caused by mutations of FOXP3.
RefLoc Nat Genet 27:20-21 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 81897
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035: 1338
Feature /codon: gcc -> acc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FOXP3_HUMAN: 384
Feature /change: A -> T
Sex XY
Relative FOXP3base; F0001 brother
//
ID A384T(2); standard; MUTATION;
Accession F0006
Systematic name g.81897G>A, c.1150G>A, r.1150g>a, p.Ala384Thr
Original code Family 4
Description A point mutation in the exon 12 leading to an amino acid
Description change
Date 17-Sep-2004 (Rel. 3, Created)
Date 17-Sep-2004 (Rel. 3, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11137992
RefAuthors Wildin, R. S., Ramsdell, F., Peake, J., Faravelli, F.,
RefAuthors Casanova, J. L., Buist, N., Levy-Lahad, E., Mazzella, M.,
RefAuthors Goulet, O., Perroni, L., Bricarelli, F. D., Byrne, G.,
RefAuthors McEuen, M., Proll, S., Appleby, M., Brunkow, M. E.
RefTitle X-linked neonatal diabetes mellitus, enteropathy and
RefTitle endocrinopathy syndrome is the human equivalent of mouse
RefTitle scurfy.
RefLoc Nat Genet 27:18-20 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 81897
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035: 1338
Feature /codon: gcc -> acc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FOXP3_HUMAN: 384
Feature /change: A -> T
Sex XY
Deceased Age at death: 4 months
Symptoms Thyroid diseases
Symptoms Hypothyroidism: present
Symptoms Other autoimmune phenomena
Symptoms Thrombocytopenia: persistent
Symptoms Skin disease
Symptoms Exfoliative dermatitis: yes
Symptoms Infections:
Symptoms Bacterial: sepsis
//
ID A384T(3); standard; MUTATION;
Accession F0011
Systematic name g.81897G>A, c.1150G>A, r.1150g>a, p.Ala384Thr
Original code 11-year-old boy
Description A point mutation in the exon 12 leading to an amino acid
Description change
Date 30-Sep-2004 (Rel. 3, Created)
Date 30-Sep-2004 (Rel. 3, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15096376
RefAuthors Nieves, D. S., Phipps, R. P., Pollock, S. J., Ochs, H. D.,
RefAuthors Zhu, Q., Scott, G. A., Ryan, C. K., Kobayashi, I., Rossi,
RefAuthors T. M., Goldsmith, L. A.
RefTitle Dermatologic and immunologic findings in the immune
RefTitle dysregulation, polyendocrinopathy, enteropathy, X-linked
RefTitle syndrome.
RefLoc Arch Dermatol 140:466-472 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 81897
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035: 1338
Feature /codon: gcc -> acc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FOXP3_HUMAN: 384
Feature /change: A -> T
Sex XY
Symptoms Diabetes mellitus
Symptoms Enteropathy: yes; villous atrophy
Symptoms Skin disease
Symptoms Alopecia: yes
//
ID A384T(4a); standard; MUTATION;
Accession F0017
Systematic name g.81897G>A, c.1150G>A, r.1150g>a, p.Ala384Thr
Original code P2
Description A point mutation in the exon 12 leading to an amino acid
Description change
Date 21-May-2008 (Rel. 1, Created)
Date 21-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17916446
RefAuthors Fuchizawa, T., Adachi, Y., Ito, Y., Higashiyama, H.,
RefAuthors Kanegane, H., Futatani, T., Kobayashi, I., Kamachi, Y.,
RefAuthors Sakamoto, T., Tsuge, I., Tanaka, H., Banham, A. H., Ochs,
RefAuthors H. D., Miyawaki, T.
RefTitle Developmental changes of FOXP3-expressing CD4+CD25+
RefTitle regulatory T cells and their impairment in patients with
RefTitle FOXP3 gene mutations.
RefLoc Clin Immunol:237-246 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 81897
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 1338
Feature /codon: gcc -> acc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 384
Feature /change: A -> T
Age 0,3
Sex XY
Ethnic origin Japan
Family history Inherited
Symptoms Growth delay/Failure to thrive
Symptoms Addisons disease
//
ID A384T(4b); standard; MUTATION;
Accession F0018
Systematic name g.81897G>A, c.1150G>A, r.1150g>a, p.Ala384Thr
Original code P3
Description A point mutation in the exon 12 leading to an amino acid
Description change
Date 21-May-2008 (Rel. 1, Created)
Date 21-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17916446
RefAuthors Fuchizawa, T., Adachi, Y., Ito, Y., Higashiyama, H.,
RefAuthors Kanegane, H., Futatani, T., Kobayashi, I., Kamachi, Y.,
RefAuthors Sakamoto, T., Tsuge, I., Tanaka, H., Banham, A. H., Ochs,
RefAuthors H. D., Miyawaki, T.
RefTitle Developmental changes of FOXP3-expressing CD4+CD25+
RefTitle regulatory T cells and their impairment in patients with
RefTitle FOXP3 gene mutations.
RefLoc Clin Immunol:237-246 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 81897
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 1338
Feature /codon: gcc -> acc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 384
Feature /change: A -> T
Age 0
Sex XY
Ethnic origin Japan
Family history Inherited
//
ID A384T(5); standard; MUTATION;
Accession F0044
Systematic name g.81897G>A, c.1150G>A, r.1150g>a, p.Ala384Thr
Original code P.11
Description A point mutation in the exon 12 leading to an amino acid
Description change
Date 22-Jul-2010 (Rel. 1, Created)
Date 22-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18951619
RefAuthors Gambineri, E., Perroni, L., Passerini, L., Bianchi, L.,
RefAuthors Doglioni, C., Meschi, F., Bonfanti, R., Sznajer, Y.,
RefAuthors Tommasini, A., Lawitschka, A., Junker, A., Dunstheimer,
RefAuthors D., Heidemann, P. H., Cazzola, G., Cipolli, M., Friedrich,
RefAuthors W., Janic, D., Azzi, N., Richmond, E., Vignola, S.,
RefAuthors Barabino, A., Chiumello, G., Azzari, C., Roncarolo, M. G.,
RefAuthors Bacchetta, R.
RefTitle Clinical and molecular profile of a new series of patients
RefTitle with immune dysregulation, polyendocrinopathy,
RefTitle enteropathy, X-linked syndrome: inconsistent correlation
RefTitle between forkhead box protein 3 expression and disease
RefTitle severity.
RefLoc J Allergy Clin Immunol:1105-1112.e1 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 81897
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 1338
Feature /codon: gcc -> acc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 384
Feature /change: A -> T
Sex XY
Symptoms Severe diarrhoea; Severe eczema; Thyroiditis;
Symptoms Alopecia; Autoimmune hemolytic anaemia;
Symptoms interstitial pneumonia; Failure to thrive;
Treatment IVIG
Treatment Immunosuppressive therapy:
Treatment Cyclosporin A
Treatment Hydrocortisone
Treatment FK506
Treatment Azathioprine
Treatment Rapamycin
IgE 1494 UI/mL
Response Antibody responses
Response anti-islet cells
Response anti-insulin antibody
Response anti-thyroglobulin antibody
//
ID A384T(6); standard; MUTATION;
Accession F0048
Systematic name g.81897G>A, c.1150G>A, r.1150g>a, p.Ala384Thr
Description A point mutation in the exon 12 leading to an amino acid
Description change
Date 22-Jul-2010 (Rel. 1, Created)
Date 22-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 19205054
RefAuthors Ohshima, M., Futamura, M., Kamachi, Y., Ito, K., Sakamoto,
RefAuthors T.
RefTitle Allergic bronchopulmonary aspergillosis in a 2-year-old
RefTitle asthmatic boy with immune dysregulation,
RefTitle polyendocrinopathy, enteropathy, X-linked.
RefLoc Pediatr Pulmonol:297-299 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 81897
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 1338
Feature /codon: gcc -> acc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 384
Feature /change: A -> T
Age 1 mo
Sex XY
Symptoms Eczematous rash; Eosinophilia;
IgE >5,000 IU/ml
//
ID R397W(1); standard; MUTATION;
Accession F0004
Systematic name g.72389C>T, c.1189C>T, r.1189c>u, p.Arg397Trp
Original code Family 1
Description A point mutation in the exon 12 leading to an amino acid
Description change
Date 17-Sep-2004 (Rel. 3, Created)
Date 17-Sep-2004 (Rel. 3, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11137992
RefAuthors Wildin, R. S., Ramsdell, F., Peake, J., Faravelli, F.,
RefAuthors Casanova, J. L., Buist, N., Levy-Lahad, E., Mazzella, M.,
RefAuthors Goulet, O., Perroni, L., Bricarelli, F. D., Byrne, G.,
RefAuthors McEuen, M., Proll, S., Appleby, M., Brunkow, M. E.
RefTitle X-linked neonatal diabetes mellitus, enteropathy and
RefTitle endocrinopathy syndrome is the human equivalent of mouse
RefTitle scurfy.
RefLoc Nat Genet 27:18-20 (2001)
RefNumber [2]
RefCrossRef PUBMED; 11295725
RefAuthors Levy-Lahad, E., Wildin, R. S.
RefTitle Neonatal diabetes mellitus, enteropathy, thrombocytopenia,
RefTitle and endocrinopathy: further evidence for an X-linked
RefTitle lethal syndrome.
RefLoc J Pediatr 138:577-580 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 81936
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035: 1377
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FOXP3_HUMAN: 397
Feature /change: R -> W
Sex XY
Deceased Age at death: 5 weeks
Symptoms Diabetes mellitus
Symptoms Thyroid diseases
Symptoms Hypothyroidism: present
Symptoms Other autoimmune phenomena
Symptoms Thrombocytopenia: persistent
Symptoms Enteropathy: yes
//
ID V408M(1); standard; MUTATION;
Accession F0030
Systematic name g.81969G>A, c.1222G>A, r.1222g>a, p.Val408Met
Original code I
Description A point mutation in the exon 12 leading to an amino acid
Description change
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18931102
RefAuthors Rubio-Cabezas, O., Minton, J. A., Caswell, R., Shield, J.
RefAuthors P., Deiss, D., Sumnik, Z., Cayssials, A., Herr, M., Loew,
RefAuthors A., Lewis, V., Ellard, S., Hattersley, A. T.
RefTitle Clinical heterogeneity in patients with FOXP3 mutations
RefTitle presenting with permanent neonatal diabetes.
RefLoc Diabetes Care:111-116 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 81969
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 1410
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 408
Feature /change: V -> M
Age 0
Sex XY
Ethnic origin Czech Republic
Symptoms Diabetes mellitus
Symptoms Age of onset: 2 days
Symptoms Thyroid diseases
Symptoms TSH levels: increased
Symptoms Nephrotic syndrome; Transient ischemic attack;
//
ID V408M(2a); standard; MUTATION;
Accession F0031
Systematic name g.81969G>A, c.1222G>A, r.1222g>a, p.Val408Met
Original code IIa
Description A point mutation in the exon 12 leading to an amino acid
Description change
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18931102
RefAuthors Rubio-Cabezas, O., Minton, J. A., Caswell, R., Shield, J.
RefAuthors P., Deiss, D., Sumnik, Z., Cayssials, A., Herr, M., Loew,
RefAuthors A., Lewis, V., Ellard, S., Hattersley, A. T.
RefTitle Clinical heterogeneity in patients with FOXP3 mutations
RefTitle presenting with permanent neonatal diabetes.
RefLoc Diabetes Care:111-116 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 81969
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 1410
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 408
Feature /change: V -> M
Age 0
Sex XY
Ethnic origin Turkey
Symptoms Diabetes mellitus
Symptoms Age of onset: 3 weeks
Symptoms Thyroid diseases
Symptoms TSH levels: decreased
Symptoms Enteropathy: yes; villous atrophy
Symptoms Infections:
Symptoms Respiratory and gastrointestinal infections
Symptoms Fungal: candida
Relative FOXP3base; F0032
//
ID V408M(2b); standard; MUTATION;
Accession F0032
Systematic name g.81969G>A, c.1222G>A, r.1222g>a, p.Val408Met
Original code IIb
Description A point mutation in the exon 12 leading to an amino acid
Description change
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18931102
RefAuthors Rubio-Cabezas, O., Minton, J. A., Caswell, R., Shield, J.
RefAuthors P., Deiss, D., Sumnik, Z., Cayssials, A., Herr, M., Loew,
RefAuthors A., Lewis, V., Ellard, S., Hattersley, A. T.
RefTitle Clinical heterogeneity in patients with FOXP3 mutations
RefTitle presenting with permanent neonatal diabetes.
RefLoc Diabetes Care:111-116 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 81969
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0035; GI:12407640; FOXP3C: 1410
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: Q9BZS1; FXP3_HUMAN: 408
Feature /change: V -> M
Age 0
Sex XY
Ethnic origin Turkey
Symptoms Diabetes mellitus
Symptoms Age of onset: 3.5 months
Symptoms Thyroid diseases
Symptoms TSH levels: decreased
Symptoms Enteropathy: yes
Symptoms Infections:
Symptoms Respiratory and gastrointestinal infections
Symptoms Fungal: candida
Symptoms Hypochromic microcytic anaemia
Relative FOXP3base; F0031
//
ID #G430X452(1); standard; MUTATION;
Accession F0005
Systematic name g.82037_82056delinsTGG, c.1290_1309delinsTGG,
Systematic name r.1290_1309delinsugg, p.Pro431fsX22
Original code Family 2
Description A frame shift indel mutation in the exon 12 leading to
Description elongation of the amino acid sequence
Date 17-Sep-2004 (Rel. 3, Created)
Date 17-Sep-2004 (Rel. 3, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11137992
RefAuthors Wildin, R. S., Ramsdell, F., Peake, J., Faravelli, F.,
RefAuthors Casanova, J. L., Buist, N., Levy-Lahad, E., Mazzella, M.,
RefAuthors Goulet, O., Perroni, L., Bricarelli, F. D., Byrne, G.,
RefAuthors McEuen, M., Proll, S., Appleby, M., Brunkow, M. E.
RefTitle X-linked neonatal diabetes mellitus, enteropathy and
RefTitle endocrinopathy syndrome is the human equivalent of mouse
RefTitle scurfy.
RefLoc Nat Genet 27:18-20 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0035: 82037
Feature /change: cccctgacct caagatcaag -> tgg
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0035: 1478
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; elongation
Feature /loc: UniProt: Q9BZS1; FOXP3_HUMAN: 430..437
Feature /change: GPXPQDQG -> GGKGGWTNRG QTGGRQRWWG QGX
Sex XY
Deceased Age at death: 10 months
Symptoms Diabetes mellitus
Symptoms Other autoimmune phenomena
Symptoms Lymphadenopathy
Symptoms Other: anemia
Symptoms Enteropathy: yes;
Symptoms Skin disease
Symptoms Excema: yes
Symptoms Infections:
Symptoms Bacterial: sepsis
//
ID #P431X457(1); standard; MUTATION;
Accession F0003
Systematic name g.82040_82041delCT, c.1293_1294delCT, r.1293_1294delcu,
Systematic name p.432fsX25
Original code Family 2; V-7
Description A frame shift deletion mutation in the exon 12 leading to
Description elongation of the amino acid sequence
Date 16-Sep-2004 (Rel. 3, Created)
Date 16-Sep-2004 (Rel. 3, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11137993
RefAuthors Bennett, C. L., Christie, J., Ramsdell, F., Brunkow, M.
RefAuthors E., Ferguson, P. J., Whitesell, L., Kelly, T. E.,
RefAuthors Saulsbury, F. T., Chance, P. F., Ochs, H. D.
RefTitle The immune dysregulation, polyendocrinopathy, enteropathy,
RefTitle X-linked syndrome (IPEX) is caused by mutations of FOXP3.
RefLoc Nat Genet 27:20-21 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0035: 82040..82041
Feature /change: -ct
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0035: 1481..1482
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; elongation
Feature /loc: UniProt: Q9BZS1; FOXP3_HUMAN: 431..432
Feature /change: PX -> PTSRSRKGGW TNRGQTGGRQ RWWGQGX
Sex XY
//
ID Downstream(1); standard; MUTATION;
Accession F0012
Description A point mutation in the first polyadenylation signal
Description downstream of the stop codon
Date 01-Oct-2004 (Rel. 3, Created)
Date 01-Oct-2004 (Rel. 3, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11685453
RefAuthors Bennett, C. L., Brunkow, M. E., Ramsdell, F., O'Briant,
RefAuthors K. C., Zhu, Q., Fuleihan, R. L., Shigeoka, A. O., Ochs,
RefAuthors H. D., Chance, P. F.
RefTitle A rare polyadenylation signal mutation of the FOXP3
RefTitle gene (AAUAAA-->AAUGAA) leads to the IPEX syndrome.
RefLoc Immunogenetics 53:435-439 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 82919
Feature /change: a -> g
Feature /genomic_region: downstream
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Sex XY
//
ID Upstream (1a); standard; MUTATION;
Accession F0021
Systematic name g.c.r.
Original code Patient IV.1
Description A frame shift deletion in the promoter region 63691 bp to
Description upstream from cDNA start point
Date 06-Jun-2008 (Rel. 1, Created)
Date 06-Jun-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17484868
RefAuthors Torgerson, T. R., Linane, A., Moes, N., Anover, S., Mateo,
RefAuthors V., Rieux-Laucat, F., Hermine, O., Vijay, S., Gambineri,
RefAuthors E., Cerf-Bensussan, N., Fischer, A., Ochs, H. D., Goulet,
RefAuthors O., Ruemmele, F. M.
RefTitle Severe food allergy as a variant of IPEX syndrome caused
RefTitle by a deletion in a noncoding region of the FOXP3 gene.
RefLoc Gastroenterology:1705-1717 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0035: 6247
Feature /change:-tggattaagaaaatgtggcacatatacaccatggaatactatgc
Feature /change:agccctaaaaaatgatgagttcatgtcctttgcagggacatgga
Feature /change:tgaaactggaaatcatcattctcagtaaactatcgcaagaacaa
Feature /change:aaaaccaaacaccgcatattctcactcataggtgggaactgaac
Feature /change:aatgagatcacatggacagaggaaggggaatatcacaccctggg
Feature /change:gactgttgtcgggtggggggaggggggagggatagcactgggag
Feature /change:atgtacctaatgctagatgatgagatagtgggtgcagtgcaaca
Feature /change:gcatggcacatgtatacatatgtaactaacctgcacaacgtgca
Feature /change:catgtaccctaaaacttaaagtataacaataaataaataaataa
Feature /change:ataaataaataaataataaataaataaaagaaaaaaaaagaagc
Feature /change:aattgttcattaaaagccagagaaaccctgcctgggcaacacag
Feature /change:tgagacctcatctctacaaaaatgaaaacaaaaaaatgtagtca
Feature /change:ggcacggtggcttgtgcatgtagttccagccactcgggaggctg
Feature /change:aggtgggaggacggctttagcctgggagccagaagttgcagtga
Feature /change:gctgaaattgcatcactgcactccagcctgggtgacacactgag
Feature /change:actctgtcgcaaacaaacaaacaaaccaagaagagggagaattc
Feature /change:acaatttcacaagatcttatactacgtattcagctctccacacg
Feature /change:gaaaaactaggatgaagcagagggcccgctcactgtcttcctga
Feature /change:caatgaaatctcaattcagagattttcagatgactcgggccagg
Feature /change:gtttcatgatttgtgattaacaaaccatgcgaagcagatgatct
Feature /change:ctgtgtcccacgcattctatgcaacaggatcagagtatgaaaga
Feature /change:aacggaatgcaaaatggttttaaagtctctgacttaaactcact
Feature /change:attttcataagaaccaaagataggtttagaagggaaaggactca
Feature /change:ctcagaatctcgccaaggctgtaagagctggtattagaacccgc
Feature /change:atgagtgcttcagcatttttcacaccaagtgatgggtgttacaa
Feature /change:acgtgttatgtattgattaaaagcagacctttacaaaagcatct
Feature /change:gaaaattgtgagctactggtttaaggatttatactcaaaacttt
Feature /change:taattcaacatagctttgactcagtttgtttccctatctgacag
Feature /change:tctatcagtcgggtgctggggcctgaactacgtttcaaataacc
Feature /change:tttatataagaagtctgttactaaagacgcagtattgttacctc
Feature /change:tctgttattaaaaatataatgctgggtcgggcacggtggctctc
Feature /change:gcctgtaatc ccggcaatttcaat
Feature /genomic_region: 5' gene flanking region
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -62303
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Age 0
Sex XY
Ethnic origin Caucasoid
Relative FOXP3base; F0022; brother
Family history Inherited
Symptoms Growth delay/Failure to thrive
Symptoms Enteropathy: yes; watery diarrhea, villous atrophy
Symptoms Skin disease
Symptoms Excema: yes
IgA 26 mg/dL
IgG 2000 mg/dL
IgM 15 mg/dL
//
ID Upstream (1b); standard; MUTATION;
Accession F0022
Systematic name g.c.r.
Original code Patient IV.2
Description A frame shift deletion in the promoter region 63691 bp to
Description upstream from cDNA start point
Date 06-Jun-2008 (Rel. 1, Created)
Date 06-Jun-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17484868
RefAuthors Torgerson, T. R., Linane, A., Moes, N., Anover, S., Mateo,
RefAuthors V., Rieux-Laucat, F., Hermine, O., Vijay, S., Gambineri,
RefAuthors E., Cerf-Bensussan, N., Fischer, A., Ochs, H. D., Goulet,
RefAuthors O., Ruemmele, F. M.
RefTitle Severe food allergy as a variant of IPEX syndrome caused
RefTitle by a deletion in a noncoding region of the FOXP3 gene.
RefLoc Gastroenterology:1705-1717 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0035: 6247
Feature /change:-tggattaagaaaatgtggcacatatacaccatggaatactatgc
Feature /change:agccctaaaaaatgatgagttcatgtcctttgcagggacatgga
Feature /change:tgaaactggaaatcatcattctcagtaaactatcgcaagaacaa
Feature /change:aaaaccaaacaccgcatattctcactcataggtgggaactgaac
Feature /change:aatgagatcacatggacagaggaaggggaatatcacaccctggg
Feature /change:gactgttgtcgggtggggggaggggggagggatagcactgggag
Feature /change:atgtacctaatgctagatgatgagatagtgggtgcagtgcaaca
Feature /change:gcatggcacatgtatacatatgtaactaacctgcacaacgtgca
Feature /change:catgtaccctaaaacttaaagtataacaataaataaataaataa
Feature /change:ataaataaataaataataaataaataaaagaaaaaaaaagaagc
Feature /change:aattgttcattaaaagccagagaaaccctgcctgggcaacacag
Feature /change:tgagacctcatctctacaaaaatgaaaacaaaaaaatgtagtca
Feature /change:ggcacggtggcttgtgcatgtagttccagccactcgggaggctg
Feature /change:aggtgggaggacggctttagcctgggagccagaagttgcagtga
Feature /change:gctgaaattgcatcactgcactccagcctgggtgacacactgag
Feature /change:actctgtcgcaaacaaacaaacaaaccaagaagagggagaattc
Feature /change:acaatttcacaagatcttatactacgtattcagctctccacacg
Feature /change:gaaaaactaggatgaagcagagggcccgctcactgtcttcctga
Feature /change:caatgaaatctcaattcagagattttcagatgactcgggccagg
Feature /change:gtttcatgatttgtgattaacaaaccatgcgaagcagatgatct
Feature /change:ctgtgtcccacgcattctatgcaacaggatcagagtatgaaaga
Feature /change:aacggaatgcaaaatggttttaaagtctctgacttaaactcact
Feature /change:attttcataagaaccaaagataggtttagaagggaaaggactca
Feature /change:ctcagaatctcgccaaggctgtaagagctggtattagaacccgc
Feature /change:atgagtgcttcagcatttttcacaccaagtgatgggtgttacaa
Feature /change:acgtgttatgtattgattaaaagcagacctttacaaaagcatct
Feature /change:gaaaattgtgagctactggtttaaggatttatactcaaaacttt
Feature /change:taattcaacatagctttgactcagtttgtttccctatctgacag
Feature /change:tctatcagtcgggtgctggggcctgaactacgtttcaaataacc
Feature /change:tttatataagaagtctgttactaaagacgcagtattgttacctc
Feature /change:tctgttattaaaaatataatgctgggtcgggcacggtggctctc
Feature /change:gcctgtaatc ccggcaatttcaat
Feature /genomic_region: 5' gene flanking region
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -62303
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Age 0,2
Sex XY
Ethnic origin Caucasoid
Relative FOXP3base; F0021; brother
Family history Inherited
Symptoms Growth delay/Failure to thrive
Symptoms Enteropathy: yes; watery diarrhea, villous atrophy
Symptoms Skin disease
Symptoms Excema: yes
IgA 18 mg/dL
IgG 300 mg/dL
IgM 38 mg/dL
//
ID Intron 1(1); standard; MUTATION;
Accession F0037
Systematic name g.68717T>G, c.-22+2T>G, r.-22+2u>g
Original code P.3
Description A point mutation in the intron 1 leading to aberrant
Description splicing
Date 22-Jul-2010 (Rel. 1, Created)
Date 22-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18951619
RefAuthors Gambineri, E., Perroni, L., Passerini, L., Bianchi, L.,
RefAuthors Doglioni, C., Meschi, F., Bonfanti, R., Sznajer, Y.,
RefAuthors Tommasini, A., Lawitschka, A., Junker, A., Dunstheimer,
RefAuthors D., Heidemann, P. H., Cazzola, G., Cipolli, M., Friedrich,
RefAuthors W., Janic, D., Azzi, N., Richmond, E., Vignola, S.,
RefAuthors Barabino, A., Chiumello, G., Azzari, C., Roncarolo, M. G.,
RefAuthors Bacchetta, R.
RefTitle Clinical and molecular profile of a new series of patients
RefTitle with immune dysregulation, polyendocrinopathy,
RefTitle enteropathy, X-linked syndrome: inconsistent correlation
RefTitle between forkhead box protein 3 expression and disease
RefTitle severity.
RefLoc J Allergy Clin Immunol:1105-1112.e1 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 68717
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Age 0
Sex XY
Symptoms Ketoacidosis
Symptoms Thyroid diseases
Symptoms Hypothyroidism
Symptoms Enteropathy: yes; watery diarrhea, villous atrophy
Symptoms Skin disease
Symptoms Eczema: severe
Symptoms Infections:
Symptoms Bacterial: sepsis
Treatment IVIG
Treatment Immunosuppressive therapy:
Treatment Cyclosporin A
Treatment FK506
Treatment Azathioprine
Treatment Methylprednisolone
Treatment Bone marrow transplantation: Yes
Treatment Donor: HLA identical MUD
Response Antibody responses
Response anti-islet cells
Response anti-insulin antibody
Response anti-glutamate decarboxylase antibody
//
ID Intron 7(1); standard; MUTATION;
Accession F0040
Systematic name g.77667G>A, c.735+5G>A, r.735+5g>a
Original code P.6
Description A point mutation in the intron 7 leading to aberrant
Description splicing
Date 22-Jul-2010 (Rel. 1, Created)
Date 22-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18951619
RefAuthors Gambineri, E., Perroni, L., Passerini, L., Bianchi, L.,
RefAuthors Doglioni, C., Meschi, F., Bonfanti, R., Sznajer, Y.,
RefAuthors Tommasini, A., Lawitschka, A., Junker, A., Dunstheimer,
RefAuthors D., Heidemann, P. H., Cazzola, G., Cipolli, M., Friedrich,
RefAuthors W., Janic, D., Azzi, N., Richmond, E., Vignola, S.,
RefAuthors Barabino, A., Chiumello, G., Azzari, C., Roncarolo, M. G.,
RefAuthors Bacchetta, R.
RefTitle Clinical and molecular profile of a new series of patients
RefTitle with immune dysregulation, polyendocrinopathy,
RefTitle enteropathy, X-linked syndrome: inconsistent correlation
RefTitle between forkhead box protein 3 expression and disease
RefTitle severity.
RefLoc J Allergy Clin Immunol:1105-1112.e1 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 77667
Feature /change: t -> a
Feature /genomic_region: intron; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Sex XY
Deceased Age at death: 9 mo
Symptoms Ketoacidosis
Symptoms Severe diarrhoea
Symptoms Eczema: Mild
Treatment Immunosuppressive therapy:
Treatment Prednisone
Treatment Azathioprine
IgE 517 UI/mL
//
ID Intron 8(1); standard; MUTATION;
Accession F0041
Systematic name g.77952A>G, c.816+4A>G, r.816+4a>g
Original code P.7
Description A point mutation in the intron 8 leading to aberrant
Description splicing
Date 22-Jul-2010 (Rel. 1, Created)
Date 22-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18951619
RefAuthors Gambineri, E., Perroni, L., Passerini, L., Bianchi, L.,
RefAuthors Doglioni, C., Meschi, F., Bonfanti, R., Sznajer, Y.,
RefAuthors Tommasini, A., Lawitschka, A., Junker, A., Dunstheimer,
RefAuthors D., Heidemann, P. H., Cazzola, G., Cipolli, M., Friedrich,
RefAuthors W., Janic, D., Azzi, N., Richmond, E., Vignola, S.,
RefAuthors Barabino, A., Chiumello, G., Azzari, C., Roncarolo, M. G.,
RefAuthors Bacchetta, R.
RefTitle Clinical and molecular profile of a new series of patients
RefTitle with immune dysregulation, polyendocrinopathy,
RefTitle enteropathy, X-linked syndrome: inconsistent correlation
RefTitle between forkhead box protein 3 expression and disease
RefTitle severity.
RefLoc J Allergy Clin Immunol:1105-1112.e1 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 77952
Feature /change: a -> g
Feature /genomic_region: intron; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +4
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Sex XY
Symptoms Keratoacidosis
Symptoms Enteropathy; Severe diarrhoea, Villous atrophy
Symptoms Eczema: Mild
Symptoms Hepatitis
Treatment Immunosuppressive therapy:
Treatment Methylprednisolone
Treatment FK506
Treatment Azathioprine
IgE >2000 UI/mL
Response Antibody responses
Response anti-glutamate decarboxylase antibody
Response anti-enterocyte antibody
Response anti-thyroglobulin antibody
//
ID Intron 10(1); standard; MUTATION;
Accession F0049
Systematic name g.81609C>G, c.1045-3C>G, r.1045-3c>g
Original code BBP
Description A point mutation in the intron 10 leading to aberrant
Description splicing
Date 03-Aug-2010 (Rel. 1, Created)
Date 03-Aug-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18489537
RefAuthors Costa-Carvalho, B. T., de Moraes-Pinto, M. I., de Almeida,
RefAuthors L. C., de Seixas Alves, M. T., Maia, R. P., de Souza, R.
RefAuthors L., Barreto, M., Lourenxo, L., Vicente, A. M., Coutinho,
RefAuthors A., Carneiro-Sampaio, M.
RefTitle A remarkable depletion of both naïve CD4+ and CD8+ with
RefTitle high proportion of memory T cells in an IPEX infant with a
RefTitle FOXP3 mutation in the forkhead domain.
RefLoc Scand J Immunol:85-91 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0035: 81609
Feature /change: c -> g
Feature /genomic_region: intron; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -3
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Age 2 mo
Sex XY
Deceased Age at death: 11 mo
Symptoms Thyroid diseases
Symptoms Alternate hypothyroidism and hyperthyroidism
Symptoms Failure to thrive
Symptoms Dehydration; Hyperglycaemia; Infected skin lesions;
Symptoms Multiple organ dysfunction; Anaemia;
Symptoms Enteropathy: yes; diarrhea, villous atrophy
Symptoms Skin disease
Symptoms Eczema: yes
Symptoms Infections:
Symptoms Bacterial: septicaemia
//
//
|
