Database ELA2base
Version 1.2
File ela2pub.html
Date 30-Jul-2014
Curator Mauno Vihinen
Address Protein Structure and Bioinformatics
Address Lund University, BMC D10, SE-22184 Lund, Sweden
Phone +46 72 526 0022
Fax +46 46 222 9328
Email Mauno Vihinen
URL http://structure.bmc.lu.se/idbase/ELA2base/
IDR factfile http://structure.bmc.lu.se/idbase/xml/idr/ff/FF86.xml
Gene ELA2
Disease Cyclic neutropenia; Congenital neutropenia
OMIM 130130
Sequence IDRefSeq:D0029; IDRefSeq:C0029; UniProt:P08246
Numbering start of the entry
Funding Tampere University Hospital Medical Research Fund
Funding European Union
Comments sequence entry reference in every entry
//
ID M1V(1); standard; MUTATION;
Accession E0109
Systematic name g.1287A>G, c.1A>G, r.1a>g, p.Met1Val
Original code No. 2
Description A point mutation in the exon 1 leading to an amino acid
Description change
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1287
Feature /change: a -> g
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 39
Feature /codon: atg -> gtg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 1
Feature /change: M -> V
Feature /note: actual mutation effect unknown
Diagnosis Congenital neutropenia
Ethnic origin Caucasoid; France
//
ID I30M/V65D(1); standard; MUTATION;
Accession E0157
Systematic name g.[1808T>G;1912T>A], c.[90T>G/194T>A],
Systematic name r.[90u>g/194u>a], p.[Ile30Met/Val65Asp]
Description Two point mutations in the exon 2 leading to two amino
Description acid changes
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 19694719
RefAuthors Lunden, L., Boxhammer, S., Carlsson, G., Ellstrom, K. G.,
RefAuthors Nordenskjold, M., Lagerstedt-Robinson, K., Fadeel, B.
RefTitle Double de novo mutations of ELANE (ELA2) in a patient with
RefTitle severe congenital neutropenia requiring high-dose G-CSF
RefTitle therapy.
RefLoc Br J Haematol:587-590 (2009)
Feature dna; 1
Feature /rnalink: 3
Feature /name: point
Feature /loc: EMBL: Y00477: 1808
Feature /change: t -> g
Feature /genomic_region: exon; 2
Feature dna; 2
Feature /rnalink: 4
Feature /name: point
Feature /loc: EMBL: Y00477: 1912
Feature /change: t -> a
Feature /genomic_region: exon; 2
Feature rna; 3
Feature /dnalink: 1
Feature /aalink: 5
Feature /name: missense
Feature /loc: EMBL: M34379; GI:187116; HUMLEUELA: 128
Feature /codon: att -> atg; 3
Feature rna; 4
Feature /dnalink: 2
Feature /aalink: 6
Feature /name: missense
Feature /loc: EMBL: M34379; GI:187116; HUMLEUELA: 232
Feature /codon: gtc -> gac; 2
Feature aa; 5
Feature /rnalink: 3
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08246; ELNE_HUMAN: 30
Feature /change: I -> M
Feature aa; 6
Feature /rnalink: 4
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08246; ELNE_HUMAN: 65
Feature /change: V -> D
Diagnosis Congenital neutropenia
Symptoms Bacterial cellulitis; Loss of muscle tone;
Symptoms Fever; otitis media; Umbilical granuloma;
Symptoms Severe periodontitis;
Age 10
Sex XY
Ethnic origin Sweden
Comment Patient's uncle had died of leukaemia.
//
ID A25V(1); standard; MUTATION;
Accession E0159
Systematic name g.1792C>T, c.74C>T, r.74c>u, p.Ala25Val
Original code P2
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 04-Aug-2010 (Rel. 1, Created)
Date 04-Aug-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20220065
RefAuthors Germeshausen, M., Zeidler, C., Stuhrmann, M., Lanciotti,
RefAuthors M., Ballmaier, M., Welte, K.
RefTitle Digenic mutations in severe congenital neutropenia.
RefLoc Haematologica:1207-1210 (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: Y00477: 1792
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: M34379; GI:187116; HUMLEUELA: 112
Feature /codon: gcg -> gtg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08246; ELNE_HUMAN: 25
Feature /change: A -> V
Diagnosis Congenital neutropenia
Symptoms Other symptoms:
Symptoms Recurrent infections;
Age 0.5
Sex XX
Ethnic origin Saudi Arabian
Comment Mutation is present also in the HAX1 gene of the patient.
Comment HAX1base; H0037;
//
ID P42L(1); standard; MUTATION;
Accession E0110
Systematic name g.1843C>T, c.125C>T, r.125c>u, p.Pro42Leu
Original code No. 3
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1843
Feature /change: c -> t
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 163
Feature /codon: ccc -> ctc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 42
Feature /change: P -> L
Diagnosis Congenital neutropenia
Ethnic origin Caucasoid; France
//
ID F43L(1); standard; MUTATION;
Accession E0111
Systematic name g.1847C>A, c.129C>A, r.129c>a, p.Phe43Leu
Original code No. 4
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1847
Feature /change: c -> a
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 167
Feature /codon: ttc -> tta; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 43
Feature /change: F -> L
Diagnosis Cyclic neutropenia
Ethnic origin Caucasoid; France
//
ID S46F(1); standard; MUTATION;
Accession E0112
Systematic name g.1855C>T, c.137C>T, r.137c>u, p.Ser46Phe
Original code No. 5
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1855
Feature /change: c -> t
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 175
Feature /codon: tcc -> ttc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 46
Feature /change: S -> F
Diagnosis Cyclic neutropenia
Ethnic origin Caucasoid; France
//
ID L47P(1); standard; MUTATION;
Accession E0113
Systematic name g.1858T>C, c.140T>C, r.140u>c, p.Leu47Pro
Original code No. 6
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1858
Feature /change: t -> c
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 178
Feature /codon: ctg -> ccg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 47
Feature /change: L -> P
Diagnosis Congenital neutropenia
Ethnic origin Caucasoid; France
//
ID H53L(1); standard; MUTATION;
Accession E0114
Systematic name g.1876A>T, c.158A>T, r.158a>u, p.His53Leu
Original code No. 7
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1876
Feature /change: a -> t
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 196
Feature /codon: cac -> ctc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 53
Feature /change: H -> L
Diagnosis Congenital neutropenia
Ethnic origin Caucasoid; France
//
ID C55Y(1); standard; MUTATION;
Accession E0095
Systematic name g.1882G>A, c.164G>A, r.164g>a, p.Cys55Tyr
Original code Patient 9
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 10-Jun-2004 (Rel. 1, Created)
Date 10-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11675333
RefAuthors Ancliff, P. J., Gale, R. E., Liesner, R., Hann, I. M.,
RefAuthors Linch, D. C.
RefTitle Mutations in the ELA2 gene encoding neutrophil elastase
RefTitle are present in most patients with sporadic severe
RefTitle congenital neutropenia but only in some patients with the
RefTitle familial form of the disease.
RefLoc Blood 98:2645-2650 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1882
Feature /change: g -> a
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 202
Feature /codon: tgc -> tac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 55
Feature /change: C -> Y
Diagnosis Congenital neutropenia
//
ID A57S(1); standard; MUTATION;
Accession E0160
Systematic name g.1887G>T, c.169G>T, r.169g>u, p.Ala57Ser
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 12-Dec-2011 (Rel. 1, Created)
Date 12-Dec-2011 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (12-Dec-2011) to ELA2base.
RefLoc Esther van de Vosse; LUMC, Albinusdreef 2, 2333ZA Leiden,
RefLoc The Netherlands; e-mail E.van_de_Vosse@LUMC.nl
RefNumber [1]
RefCrossRef PUBMED; 20803142
RefAuthors van de Vosse, E., Verhard, E. M., Tool, A. J., de Visser,
RefAuthors A. W., Kuijpers, T. W., Hiemstra, P. S., van Dissel, J. T.
RefTitle Severe congenital neutropenia in a multigenerational
RefTitle family with a novel neutrophil elastase (ELANE) mutation.
RefLoc Ann Hematol:151-158 (2011)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: Y00477: 1887
Feature /change: g -> t
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: M34379; GI:187116; HUMLEUELA: 207
Feature /codon: gcc -> tcc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08246; ELNE_HUMAN: 57
Feature /change: A -> S
mRNA level Normal
Diagnosis Congenital neutropenia
Symptoms Infections:
Symptoms Oral ulcerations; Mucosal infections;
Symptoms Others:
Symptoms arthralgia, chronic fatigue, caus of death: large B cell non-Hodgkin’s lymphoma in the brain
Sex XX
Ethnic origin Caucasoid; Nederland
Family history Inherited
Relative Description of pedigree: large multigenerational family with
Relative in total 8 patients
//
ID A57T(1); standard; MUTATION;
Accession E0071
Systematic name g.1887G>A, c.169G>A, r.169g>a, p.Ala57Thr
Original code Subject 1
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 14-Oct-2003 (Rel. 1, Created)
Date 14-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1887
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 207
Feature /codon: gcc -> acc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 57
Feature /change: A -> T
Diagnosis Congenital neutropenia
Sex XY
//
ID A57T(2); standard; MUTATION;
Accession E0136
Systematic name g.1887G>A, c.169G>A, r.169g>a, p.Ala57Thr
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 20-Feb-2007 (Rel. 1, Created)
Date 20-Feb-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17202606
RefAuthors Thomas, M., Jayandharan, G., Chandy, M.
RefTitle Molecular screening of the neutrophil elastase gene in
RefTitle congenital neutropenia.
RefLoc Indian Pediatr:1081-1084 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1887
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 207
Feature /codon: gcc -> acc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 57
Feature /change: A -> T
Diagnosis Congenital neutropenia
Symptoms Other symptoms:
Symptoms neck abscess, ear lobe infection, anal fissure, otitis
Symptoms media with facial palsy, repeated episodes of fever
Age 19 mo
Sex XX
Family history De novo
//
ID A57V(1); standard; MUTATION;
Accession E0156
Systematic name g.1888C>T, c.170C>T, r.170c>u, p.Ala57Val
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18946670
RefAuthors Lee, S. T., Yoon, H. S., Kim, H. J., Lee, J. H., Park, J.
RefAuthors H., Kim, S. H., Seo, J. J., Im, H. J.
RefTitle A novel mutation ala57Val of the ELA2 gene in a korean boy
RefTitle with severe congenital neutropenia.
RefLoc Ann Hematol:593-595 (2009)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: Y00477: 1888
Feature /change: c -> t
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: M34379; GI:187116; HUMLEUELA: 208
Feature /codon: gcc -> gtc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08246; ELNE_HUMAN: 57
Feature /change: A -> V
Diagnosis Congenital neutropenia
Symptoms Recurrent ear, skin and respiratory tract infections;
Age 5
Sex XY
Ethnic origin Korea
//
ID I60T(1); standard; MUTATION;
Accession E0072
Systematic name g.1897T>C, c.179T>C, r.179u>c, p.Ile60Thr
Original code Subject 2
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 14-Oct-2003 (Rel. 1, Created)
Date 14-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1897
Feature /change: t -> c
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 217
Feature /codon: att -> act; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 60
Feature /change: I -> T
Diagnosis Congenital neutropenia
Sex XY
//
ID A61V(1a); standard; MUTATION;
Accession E0001
Systematic name g.1900C>T, c.182C>T, r.182c>u, p.Ala61Val
Original code Family 621
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 08-Oct-2003 (Rel. 1, Created)
Date 08-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1900
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 220
Feature /codon: gcg -> gtg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 61
Feature /change: A -> V
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0002 son
Relative ELA2base; E0003 son
Relative ELA2base; E0004 son
Relative ELA2base; E0005 daughter
Relative ELA2base; E0006 granddaughter
Relative ELA2base; E0007 granddaughter
Relative ELA2base; E0008 grandson
Relative ELA2base; E0009 granddaughter
//
ID A61V(1b); standard; MUTATION;
Accession E0002
Systematic name g.1900C>T, c.182C>T, r.182c>u, p.Ala61Val
Original code Family 621;3
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 08-Oct-2003 (Rel. 1, Created)
Date 08-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1900
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 220
Feature /codon: gcg -> gtg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 61
Feature /change: A -> V
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0001 father
Relative ELA2base; E0003 brother
Relative ELA2base; E0004 brother
Relative ELA2base; E0005 sister
Relative ELA2base; E0006 daughter
Relative ELA2base; E0007 niese
Relative ELA2base; E0008 nephew
Relative ELA2base; E0009 niese
//
ID A61V(1c); standard; MUTATION;
Accession E0003
Systematic name g.1900C>T, c.182C>T, r.182c>u, p.Ala61Val
Original code Family 621
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 08-Oct-2003 (Rel. 1, Created)
Date 08-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1900
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 220
Feature /codon: gcg -> gtg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 61
Feature /change: A -> V
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0001 father
Relative ELA2base; E0002 brother
Relative ELA2base; E0004 brother
Relative ELA2base; E0005 sister
Relative ELA2base; E0006 niese
Relative ELA2base; E0007 daughter
Relative ELA2base; E0008 nephew
Relative ELA2base; E0009 niese
//
ID A61V(1d); standard; MUTATION;
Accession E0004
Systematic name g.1900C>T, c.182C>T, r.182c>u, p.Ala61Val
Original code Family 621
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 08-Oct-2003 (Rel. 1, Created)
Date 08-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1900
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 220
Feature /codon: gcg -> gtg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 61
Feature /change: A -> V
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0001 father
Relative ELA2base; E0002 brother
Relative ELA2base; E0003 brother
Relative ELA2base; E0005 sister
Relative ELA2base; E0006 niese
Relative ELA2base; E0007 niese
Relative ELA2base; E0008 nephew
Relative ELA2base; E0009 niese
//
ID A61V(1e); standard; MUTATION;
Accession E0005
Systematic name g.1900C>T, c.182C>T, r.182c>u, p.Ala61Val
Original code Family 621
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 08-Oct-2003 (Rel. 1, Created)
Date 08-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1900
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 220
Feature /codon: gcg -> gtg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 61
Feature /change: A -> V
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0001 father
Relative ELA2base; E0002 brother
Relative ELA2base; E0003 brother
Relative ELA2base; E0004 brother
Relative ELA2base; E0006 niese
Relative ELA2base; E0007 niese
Relative ELA2base; E0008 son
Relative ELA2base; E0009 daughter
//
ID A61V(1f); standard; MUTATION;
Accession E0006
Systematic name g.1900C>T, c.182C>T, r.182c>u, p.Ala61Val
Original code Family 621
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 08-Oct-2003 (Rel. 1, Created)
Date 08-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1900
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 220
Feature /codon: gcg -> gtg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 61
Feature /change: A -> V
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0001 grandfather
Relative ELA2base; E0002 father
Relative ELA2base; E0003 uncle
Relative ELA2base; E0004 uncle
Relative ELA2base; E0005 aunt
Relative ELA2base; E0007 cousin
Relative ELA2base; E0008 cousin
Relative ELA2base; E0009 cousin
//
ID A61V(1g); standard; MUTATION;
Accession E0007
Systematic name g.1900C>T, c.182C>T, r.182c>u, p.Ala61Val
Original code Family 621
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 08-Oct-2003 (Rel. 1, Created)
Date 08-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1900
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 220
Feature /codon: gcg -> gtg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 61
Feature /change: A -> V
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0001 grandfather
Relative ELA2base; E0002 uncle
Relative ELA2base; E0003 father
Relative ELA2base; E0004 uncle
Relative ELA2base; E0005 aunt
Relative ELA2base; E0006 cousin
Relative ELA2base; E0008 cousin
Relative ELA2base; E0009 cousin
//
ID A61V(1h); standard; MUTATION;
Accession E0008
Systematic name g.1900C>T, c.182C>T, r.182c>u, p.Ala61Val
Original code Family 621;13
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 08-Oct-2003 (Rel. 1, Created)
Date 08-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1900
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 220
Feature /codon: gcg -> gtg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 61
Feature /change: A -> V
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0001 grandfather
Relative ELA2base; E0002 uncle
Relative ELA2base; E0003 uncle
Relative ELA2base; E0004 uncle
Relative ELA2base; E0005 mother
Relative ELA2base; E0006 cousin
Relative ELA2base; E0007 cousin
Relative ELA2base; E0009 sister
//
ID A61V(1i); standard; MUTATION;
Accession E0009
Systematic name g.1900C>T, c.182C>T, r.182c>u, p.Ala61Val
Original code Family 621
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 08-Oct-2003 (Rel. 1, Created)
Date 08-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1900
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 220
Feature /codon: gcg -> gtg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 61
Feature /change: A -> V
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0001 grandfather
Relative ELA2base; E0002 uncle
Relative ELA2base; E0003 uncle
Relative ELA2base; E0004 uncle
Relative ELA2base; E0005 mother
Relative ELA2base; E0006 cousin
Relative ELA2base; E0007 cousin
Relative ELA2base; E0008 brother
//
ID A61V(2); standard; MUTATION;
Accession E0106
Systematic name g.1900C>T, c.182C>T, r.182c>u, p.Ala61Val
Original code Patient 2 ref.[1]; P.10 ref.[2]
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 14-Jun-2004 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 12554799
RefAuthors Kawaguchi, H., Kobayashi, M., Nakamura, K., Konishi, N.,
RefAuthors Miyagawa, S., Sato, T., Toyoda, H., Komada, Y., Kojima,
RefAuthors S., Todoroki, Y., Ueda, K., Katoh, O.
RefTitle Dysregulation of transcriptions in primary granule
RefTitle constituents during myeloid proliferation and
RefTitle differentiation in patients with severe congenital
RefTitle neutropenia.
RefLoc J Leukoc Biol 73:225-234 (2003)
RefNumber [2]
RefCrossRef PUBMED; 18611981
RefAuthors Ishikawa, N., Okada, S., Miki, M., Shirao, K., Kihara, H.,
RefAuthors Tsumura, M., Nakamura, K., Kawaguchi, H., Ohtsubo, M.,
RefAuthors Yasunaga, S., Matsubara, K., Sako, M., Hara, J., Shiohara,
RefAuthors M., Kojima, S., Sato, T., Takihara, Y., Kobayashi, M.
RefTitle Neurodevelopmental abnormalities associated with severe
RefTitle congenital neutropenia due to the R86X mutation in the
RefTitle HAX1 gene.
RefLoc J Med Genet:802-807 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1900
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 220
Feature /codon: gcg -> gtg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 61
Feature /change: A -> V
Diagnosis Congenital neutropenia
Symptoms Infections:
Symptoms Gingivitis;
Symptoms Other symptoms:
Symptoms Upper respiratory infections
Age 3 mo
Sex XY
Ethnic origin Japan
WBC 9.500 /ml
Neutrophil 0.095 /ml
Treatment Granulocyte colony stimulating factor
//
ID #P62-8(1); standard; MUTATION;
Accession E0147
Systematic name g.1903_1926delCCAACTTCGTCATGTCGGCCGCGC,
Systematic name c.185_208delCCAACTTCGTCATGTCGGCCGCGC,
Systematic name r.185_208delccaacuucgucaugucggccgcgc, p.Pro62del
Original code P4
Description An inframe deletion in the exon 2 leading to an amino acid
Description change
Date 02-May-2008 (Rel. 1, Created)
Date 02-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17311988
RefAuthors Donini, M., Fontana, S., Savoldi, G., Vermi, W., Tassone,
RefAuthors L., Gentili, F., Zenaro, E., Ferrari, D., Notarangelo, L.
RefAuthors D., Porta, F., Facchetti, F., Notarangelo, L. D., Dusi,
RefAuthors S., Badolato, R.
RefTitle G-CSF treatment of severe congenital neutropenia reverses
RefTitle neutropenia but does not correct the underlying functional
RefTitle deficiency of the neutrophil in defending against
RefTitle microorganisms.
RefLoc Blood:4716-4723 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: EMBL: Y00477: 1903..1926
Feature /change: -ccaacttcgt catgtcggcc gcgc
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: EMBL: M34379; GI:187116; HUMLEUELA: 223..246
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: SWISSPROT: P08246; ELNE_HUMAN: 62..70
Feature /change: PNFVMSAAH -> H
Diagnosis Congenital neutropenia
Age 0,4
Ethnic origin Italy
//
ID C71R(1); standard; MUTATION;
Accession E0103
Systematic name g.1929T>C, c.211T>C, r.211u>c, p.Cys71Arg
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 11-Jun-2004 (Rel. 1, Created)
Date 11-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12091371
RefAuthors Ancliff, P. J., Gale, R. E., Watts, M. J., Liesner, R.,
RefAuthors Hann, I. M., Strobel, S., Linch, D. C.
RefTitle Paternal mosaicism proves the pathogenic nature of
RefTitle mutations in neutrophil elastase in severe congenital
RefTitle neutropenia.
RefLoc Blood 100:707-709 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1929
Feature /change: t -> c
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 249
Feature /codon: tgc -> cgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 71
Feature /change: C -> R
Diagnosis Congenital neutropenia
Sex XX
Ethnic origin Caucasoid; Northern European
Comment The healthy father of the patient was demonstrated to be
Comment mosaic for the mutation
//
ID C71S(1); standard; MUTATION;
Accession E0073
Systematic name g.1929T>A, c.211T>A, r.211u>a, p.Cys71Ser
Original code Subject 3
Description A point mutation in the exon 2 leading to an amino acid
Description change
Date 14-Oct-2003 (Rel. 1, Created)
Date 14-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1929
Feature /change: t -> a
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 249
Feature /codon: tgc -> agc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 71
Feature /change: C -> S
Diagnosis Congenital neutropenia
Sex XX
//
ID R81P(1); standard; MUTATION;
Accession E0115
Systematic name g.2190G>C, c.242G>C, r.242g>c, p.Arg81Pro
Original code No. 14
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 2190
Feature /change: g -> c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 280
Feature /codon: cgg -> ccg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 81
Feature /change: R -> P
Diagnosis Congenital neutropenia
Ethnic origin Caucasoid; France
//
ID R81P(2); standard; MUTATION;
Accession E0150
Systematic name g.2190G>C, c.242G>C, r.242g>c, p.Arg81Pro
Original code P.9
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18611981
RefAuthors Ishikawa, N., Okada, S., Miki, M., Shirao, K., Kihara, H.,
RefAuthors Tsumura, M., Nakamura, K., Kawaguchi, H., Ohtsubo, M.,
RefAuthors Yasunaga, S., Matsubara, K., Sako, M., Hara, J., Shiohara,
RefAuthors M., Kojima, S., Sato, T., Takihara, Y., Kobayashi, M.
RefTitle Neurodevelopmental abnormalities associated with severe
RefTitle congenital neutropenia due to the R86X mutation in the
RefTitle HAX1 gene.
RefLoc J Med Genet:802-807 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: Y00477: 2190
Feature /change: g -> c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: M34379; GI:187116; HUMLEUELA: 280
Feature /codon: cgg -> ccg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08246; ELNE_HUMAN: 81
Feature /change: R -> P
Diagnosis Congenital neutropenia
Age 4 mo
Sex XX
Ethnic origin Japan
WBC 11.000 /ml
Neutrophil 0.110 /ml
Treatment Granulocyte colony stimulating factor
//
ID V82M(1); standard; MUTATION;
Accession E0116
Systematic name g.2192G>A, c.244G>A, r.244g>a, p.Val82Met
Original code No. 15
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 2192
Feature /change: g -> a
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 282
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 82
Feature /change: V -> M
Diagnosis Cyclic neutropenia
Ethnic origin Caucasoid; France
//
ID L84P(1); standard; MUTATION;
Accession E0117
Systematic name g.2199T>C, c.251T>C, r.251u>c, p.Leu84Pro
Original code No. 16
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 2199
Feature /change: t -> c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 289
Feature /codon: ctg -> ccg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 84
Feature /change: L -> P
Diagnosis Congenital neutropenia
Ethnic origin Caucasoid; France
//
ID G85E(1); standard; MUTATION;
Accession E0096
Systematic name g.2202G>A, c.254G>A, r.254g>a, p.Gly85Glu
Original code Patient 10
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 10-Jun-2004 (Rel. 1, Created)
Date 10-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11675333
RefAuthors Ancliff, P. J., Gale, R. E., Liesner, R., Hann, I. M.,
RefAuthors Linch, D. C.
RefTitle Mutations in the ELA2 gene encoding neutrophil elastase
RefTitle are present in most patients with sporadic severe
RefTitle congenital neutropenia but only in some patients with the
RefTitle familial form of the disease.
RefLoc Blood 98:2645-2650 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 2202
Feature /change: g -> a
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 292
Feature /codon: gga -> gaa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 85
Feature /change: G -> E
Diagnosis Congenital neutropenia
//
ID G85E(2); standard; MUTATION;
Accession E0152
Systematic name g.2202G>A, c.254G>A, r.254g>a, p.Gly85Glu
Original code P.13
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18611981
RefAuthors Ishikawa, N., Okada, S., Miki, M., Shirao, K., Kihara, H.,
RefAuthors Tsumura, M., Nakamura, K., Kawaguchi, H., Ohtsubo, M.,
RefAuthors Yasunaga, S., Matsubara, K., Sako, M., Hara, J., Shiohara,
RefAuthors M., Kojima, S., Sato, T., Takihara, Y., Kobayashi, M.
RefTitle Neurodevelopmental abnormalities associated with severe
RefTitle congenital neutropenia due to the R86X mutation in the
RefTitle HAX1 gene.
RefLoc J Med Genet:802-807 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: Y00477: 2202
Feature /change: g -> a
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: M34379; GI:187116; HUMLEUELA: 292
Feature /codon: gga -> gaa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08246; ELNE_HUMAN: 85
Feature /change: G -> E
Diagnosis Congenital neutropenia
Age 4 mo
Sex XX
Ethnic origin Japan
WBC 6.800 /ml
Neutrophil 0.034 /ml
Treatment Stem cell transplants
//
ID V101M(1); standard; MUTATION;
Accession E0074
Systematic name g.2249G>A, c.301G>A, r.301g>a, p.Val101Met
Original code Subject 4
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 14-Oct-2003 (Rel. 1, Created)
Date 14-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 2249
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 339
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 101
Feature /change: V -> M
Diagnosis Congenital neutropenia
Sex XX
//
ID V101M(2); standard; MUTATION;
Accession E0075
Systematic name g.2249G>A, c.301G>A, r.301g>a, p.Val101Met
Original code Subject 5
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 14-Oct-2003 (Rel. 1, Created)
Date 14-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 2249
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 339
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 101
Feature /change: V -> M
Diagnosis Congenital neutropenia
Sex XX
//
ID V101M(3); standard; MUTATION;
Accession E0151
Systematic name g.2249G>A, c.301G>A, r.301g>a, p.Val101Met
Original code P.12
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18611981
RefAuthors Ishikawa, N., Okada, S., Miki, M., Shirao, K., Kihara, H.,
RefAuthors Tsumura, M., Nakamura, K., Kawaguchi, H., Ohtsubo, M.,
RefAuthors Yasunaga, S., Matsubara, K., Sako, M., Hara, J., Shiohara,
RefAuthors M., Kojima, S., Sato, T., Takihara, Y., Kobayashi, M.
RefTitle Neurodevelopmental abnormalities associated with severe
RefTitle congenital neutropenia due to the R86X mutation in the
RefTitle HAX1 gene.
RefLoc J Med Genet:802-807 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: Y00477: 2249
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: M34379; GI:187116; HUMLEUELA: 339
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08246; ELNE_HUMAN: 101
Feature /change: V -> M
Diagnosis Congenital neutropenia
Age 2 mo
Sex XY
Ethnic origin Japan
WBC 7.200 /ml
Neutrophil 0.036 /ml
Treatment Stem cell transplants
//
ID L121H(1); standard; MUTATION;
Accession E0149
Systematic name g.2310T>A, c.362T>A, r.362u>a, p.Leu121His
Original code P.2
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18513342
RefAuthors Carlsson, G., van't Hooft, I., Melin, M., Entesarian, M.,
RefAuthors Laurencikas, E., Nennesmo, I., TrebiA�ska, A., Grzybowska,
RefAuthors E., Palmblad, J., Dahl, N., Nordenskjold, M., Fadeel, B.,
RefAuthors Henter, J. I.
RefTitle Central nervous system involvement in severe congenital
RefTitle neutropenia: neurological and neuropsychological
RefTitle abnormalities associated with specific HAX1 mutations.
RefLoc J Intern Med:388-400 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: Y00477: 2310
Feature /change: t -> a
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: M34379; GI:187116; HUMLEUELA: 400
Feature /codon: ctc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08246; ELNE_HUMAN: 121
Feature /change: L -> H
Diagnosis Congenital neutropenia
Age 30
Sex XX
Ethnic origin Sweden
//
ID L121P(1); standard; MUTATION;
Accession E0118
Systematic name g.2310T>C, c.362T>C, r.362u>c, p.Leu121Pro
Original code No. 19
Description A point mutation in the exon 3 leading to an amino acid
Description change
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 2310
Feature /change: t -> c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 400
Feature /codon: ctc -> ccc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 121
Feature /change: L -> P
Diagnosis Congenital neutropenia
Ethnic origin Caucasoid; France
//
ID S126L(1); standard; MUTATION;
Accession E0076
Systematic name g.4495C>T, c.377C>T, r.377c>u, p.Ser126Leu
Original code Subject 6
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 14-Oct-2003 (Rel. 1, Created)
Date 14-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4495
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 415
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 126
Feature /change: S -> L
Diagnosis Congenital neutropenia
Sex XY
//
ID S126L(2); standard; MUTATION;
Accession E0098
Systematic name g.4495C>T, c.377C>T, r.377c>u, p.Ser126Leu
Original code Patient 12
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 10-Jun-2004 (Rel. 1, Created)
Date 10-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11675333
RefAuthors Ancliff, P. J., Gale, R. E., Liesner, R., Hann, I. M.,
RefAuthors Linch, D. C.
RefTitle Mutations in the ELA2 gene encoding neutrophil elastase
RefTitle are present in most patients with sporadic severe
RefTitle congenital neutropenia but only in some patients with the
RefTitle familial form of the disease.
RefLoc Blood 98:2645-2650 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4495
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 415
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 126
Feature /change: S -> L
Diagnosis Congenital neutropenia
//
ID S126L(3); standard; MUTATION;
Accession E0099
Systematic name g.4495C>T, c.377C>T, r.377c>u, p.Ser126Leu
Original code Patient 13
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 10-Jun-2004 (Rel. 1, Created)
Date 10-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11675333
RefAuthors Ancliff, P. J., Gale, R. E., Liesner, R., Hann, I. M.,
RefAuthors Linch, D. C.
RefTitle Mutations in the ELA2 gene encoding neutrophil elastase
RefTitle are present in most patients with sporadic severe
RefTitle congenital neutropenia but only in some patients with the
RefTitle familial form of the disease.
RefLoc Blood 98:2645-2650 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4495
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 415
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 126
Feature /change: S -> L
Diagnosis Congenital neutropenia
//
ID S126L(4); standard; MUTATION;
Accession E0107
Systematic name g.4495C>T, c.377C>T, r.377c>u, p.Ser126Leu
Original code Patient 4 ref.[1]; P.8 ref.[2]
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 14-Jun-2004 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 12554799
RefAuthors Kawaguchi, H., Kobayashi, M., Nakamura, K., Konishi, N.,
RefAuthors Miyagawa, S., Sato, T., Toyoda, H., Komada, Y., Kojima,
RefAuthors S., Todoroki, Y., Ueda, K., Katoh, O.
RefTitle Dysregulation of transcriptions in primary granule
RefTitle constituents during myeloid proliferation and
RefTitle differentiation in patients with severe congenital
RefTitle neutropenia.
RefLoc J Leukoc Biol 73:225-234 (2003)
RefNumber [2]
RefCrossRef PUBMED; 18611981
RefAuthors Ishikawa, N., Okada, S., Miki, M., Shirao, K., Kihara, H.,
RefAuthors Tsumura, M., Nakamura, K., Kawaguchi, H., Ohtsubo, M.,
RefAuthors Yasunaga, S., Matsubara, K., Sako, M., Hara, J., Shiohara,
RefAuthors M., Kojima, S., Sato, T., Takihara, Y., Kobayashi, M.
RefTitle Neurodevelopmental abnormalities associated with severe
RefTitle congenital neutropenia due to the R86X mutation in the
RefTitle HAX1 gene.
RefLoc J Med Genet:802-807 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4495
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 415
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 126
Feature /change: S -> L
Diagnosis Congenital neutropenia
Age 8 mo
Sex XX
Ethnic origin Japan
WBC 9.200 /ml
Neutrophil 0.092 /ml
Treatment Stem cell transplants
//
ID S126L(5); standard; MUTATION;
Accession E0119
Systematic name g.4495C>T, c.377C>T, r.377c>u, p.Ser126Leu
Original code No. 21
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4495
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 415
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 126
Feature /change: S -> L
Diagnosis Cyclic neutropenia
Ethnic origin Caucasoid; France
//
ID S126L(6a); standard; MUTATION;
Accession E0137
Systematic name g.4495C>T, c.377C>T, r.377c>u, p.Ser126Leu
Original code Child 1
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 23-Feb-2007 (Rel. 1, Created)
Date 23-Feb-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16737875
RefAuthors Boxer, L. A., Stein, S., Buckley, D., Bolyard, A. A.,
RefAuthors Dale, D. C.
RefTitle Strong evidence for autosomal dominant inheritance of
RefTitle severe congenital neutropenia associated with ELA2
RefTitle mutations.
RefLoc J Pediatr:633-636 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4495
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 415
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 126
Feature /change: S -> L
Diagnosis Congenital neutropenia
Sex XY
Family history Inherited
Relative ELA2base; E0138 half-brother
Relative ELA2base; E0139 half-brother
Relative ELA2base; E0140 half-brother
Relative ELA2base; E0141 half-sister
Comment No mutation was detected in ELA2 of the mother; child was
Comment concieved using donor sperm from the sperm bank
//
ID S126L(6b); standard; MUTATION;
Accession E0138
Systematic name g.4495C>T, c.377C>T, r.377c>u, p.Ser126Leu
Original code Child 2
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 23-Feb-2007 (Rel. 1, Created)
Date 23-Feb-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16737875
RefAuthors Boxer, L. A., Stein, S., Buckley, D., Bolyard, A. A.,
RefAuthors Dale, D. C.
RefTitle Strong evidence for autosomal dominant inheritance of
RefTitle severe congenital neutropenia associated with ELA2
RefTitle mutations.
RefLoc J Pediatr:633-636 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4495
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 415
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 126
Feature /change: S -> L
Diagnosis Congenital neutropenia
Sex XY
Family history Inherited
Relative ELA2base; E0137 half-brother
Relative ELA2base; E0139 half-brother
Relative ELA2base; E0140 half-brother
Relative ELA2base; E0141 half-sister
Comment No mutation was detected in ELA2 of the mother; child was
Comment concieved using donor sperm from the sperm bank
//
ID S126L(6c); standard; MUTATION;
Accession E0139
Systematic name g.4495C>T, c.377C>T, r.377c>u, p.Ser126Leu
Original code Child 3A
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 23-Feb-2007 (Rel. 1, Created)
Date 23-Feb-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16737875
RefAuthors Boxer, L. A., Stein, S., Buckley, D., Bolyard, A. A.,
RefAuthors Dale, D. C.
RefTitle Strong evidence for autosomal dominant inheritance of
RefTitle severe congenital neutropenia associated with ELA2
RefTitle mutations.
RefLoc J Pediatr:633-636 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4495
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 415
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 126
Feature /change: S -> L
Diagnosis Congenital neutropenia
Sex XY
Family history Inherited
Relative ELA2base; E0137 half-brother
Relative ELA2base; E0138 half-brother
Relative ELA2base; E0140 brother
Relative ELA2base; E0141 half-sister
Comment No mutation was detected in ELA2 of the mother; child was
Comment concieved using donor sperm from the sperm bank
//
ID S126L(6d); standard; MUTATION;
Accession E0140
Systematic name g.4495C>T, c.377C>T, r.377c>u, p.Ser126Leu
Original code Child 3B
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 23-Feb-2007 (Rel. 1, Created)
Date 23-Feb-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16737875
RefAuthors Boxer, L. A., Stein, S., Buckley, D., Bolyard, A. A.,
RefAuthors Dale, D. C.
RefTitle Strong evidence for autosomal dominant inheritance of
RefTitle severe congenital neutropenia associated with ELA2
RefTitle mutations.
RefLoc J Pediatr:633-636 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4495
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 415
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 126
Feature /change: S -> L
Diagnosis Congenital neutropenia
Sex XY
Family history Inherited
Relative ELA2base; E0137 half-brother
Relative ELA2base; E0138 half-brother
Relative ELA2base; E0139 brother
Relative ELA2base; E0141 half-sister
Comment No mutation was detected in ELA2 of the mother; child was
Comment concieved using donor sperm from the sperm bank
//
ID S126L(6e); standard; MUTATION;
Accession E0141
Systematic name g.4495C>T, c.377C>T, r.377c>u, p.Ser126Leu
Original code Child 4
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 23-Feb-2007 (Rel. 1, Created)
Date 23-Feb-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16737875
RefAuthors Boxer, L. A., Stein, S., Buckley, D., Bolyard, A. A.,
RefAuthors Dale, D. C.
RefTitle Strong evidence for autosomal dominant inheritance of
RefTitle severe congenital neutropenia associated with ELA2
RefTitle mutations.
RefLoc J Pediatr:633-636 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4495
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 415
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 126
Feature /change: S -> L
Diagnosis Congenital neutropenia
Sex XX
Family history Inherited
Relative ELA2base; E0137 half-brother
Relative ELA2base; E0138 half-brother
Relative ELA2base; E0139 half-brother
Relative ELA2base; E0140 half-brother
Comment No mutation was detected in ELA2 of the mother; child was
Comment concieved using donor sperm from the sperm bank
//
ID A127D(1); standard; MUTATION;
Accession E0148
Systematic name g.4498C>A, c.380C>A, r.380c>a, p.Ala127Asp
Original code P5
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 02-May-2008 (Rel. 1, Created)
Date 02-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17311988
RefAuthors Donini, M., Fontana, S., Savoldi, G., Vermi, W., Tassone,
RefAuthors L., Gentili, F., Zenaro, E., Ferrari, D., Notarangelo, L.
RefAuthors D., Porta, F., Facchetti, F., Notarangelo, L. D., Dusi,
RefAuthors S., Badolato, R.
RefTitle G-CSF treatment of severe congenital neutropenia reverses
RefTitle neutropenia but does not correct the underlying functional
RefTitle deficiency of the neutrophil in defending against
RefTitle microorganisms.
RefLoc Blood:4716-4723 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: Y00477: 4498
Feature /change: c -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: M34379; GI:187116; HUMLEUELA: 418
Feature /codon: gcc -> gac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08246; ELNE_HUMAN: 127
Feature /change: A -> D
Diagnosis Congenital neutropenia
Age 0,3
Ethnic origin Italy
//
ID A127P(1); standard; MUTATION;
Accession E0120
Systematic name g.4497G>C, c.379G>C, r.379g>c, p.Ala127Pro
Original code No. 22
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4497
Feature /change: g -> c
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 417
Feature /codon: gcc -> ccc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 127
Feature /change: A -> P
Diagnosis Congenital neutropenia
Ethnic origin Caucasoid; France
//
ID #A127-1(1); standard; MUTATION;
Accession E0154
Systematic name g.4498_4500delCCA, c.380_382delCCA, r.380_382delcca,
Systematic name p.Ala127del
Original code P.15
Description An inframe deletion in the exon 4 leading to an amino acid
Description change
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18611981
RefAuthors Ishikawa, N., Okada, S., Miki, M., Shirao, K., Kihara, H.,
RefAuthors Tsumura, M., Nakamura, K., Kawaguchi, H., Ohtsubo, M.,
RefAuthors Yasunaga, S., Matsubara, K., Sako, M., Hara, J., Shiohara,
RefAuthors M., Kojima, S., Sato, T., Takihara, Y., Kobayashi, M.
RefTitle Neurodevelopmental abnormalities associated with severe
RefTitle congenital neutropenia due to the R86X mutation in the
RefTitle HAX1 gene.
RefLoc J Med Genet:802-807 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: EMBL: Y00477: 4498..4500
Feature /change: -cca
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: EMBL: M34379; GI:187116; HUMLEUELA: 418..420
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: SWISSPROT: P08246; ELNE_HUMAN: 127..128
Feature /change: AT -> A
Diagnosis Congenital neutropenia
Age 4 mo
Sex XY
Ethnic origin Japan
WBC 9.400 /ml
Neutrophil 0.094 /ml
Treatment Granulocyte colony stimulating factor
//
ID P139L(1); standard; MUTATION;
Accession E0077
Systematic name g.4534C>T, c.416C>T, r.416c>u, p.Pro139Leu
Original code Subject 7
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 14-Oct-2003 (Rel. 1, Created)
Date 14-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4534
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 454
Feature /codon: ccg -> ctg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 139
Feature /change: P -> L
Diagnosis Congenital neutropenia
Sex XX
//
ID P139L(2); standard; MUTATION;
Accession E0078
Systematic name g.4534C>T, c.416C>T, r.416c>u, p.Pro139Leu
Original code Subject 8
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 14-Oct-2003 (Rel. 1, Created)
Date 14-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4534
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 454
Feature /codon: ccg -> ctg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 139
Feature /change: P -> L
Diagnosis Congenital neutropenia
Sex XX
//
ID P139L(3); standard; MUTATION;
Accession E0079
Systematic name g.4534C>T, c.416C>T, r.416c>u, p.Pro139Leu
Original code Subject 9
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 14-Oct-2003 (Rel. 1, Created)
Date 14-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4534
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 454
Feature /codon: ccg -> ctg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 139
Feature /change: P -> L
Diagnosis Congenital neutropenia
Sex XY
//
ID P139L(4); standard; MUTATION;
Accession E0080
Systematic name g.4534C>T, c.416C>T, r.416c>u, p.Pro139Leu
Original code Subject 10
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 14-Oct-2003 (Rel. 1, Created)
Date 14-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4534
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 454
Feature /codon: ccg -> ctg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 139
Feature /change: P -> L
Diagnosis Congenital neutropenia
Sex XX
//
ID P139L(5); standard; MUTATION;
Accession E0093
Systematic name g.4534C>T, c.416C>T, r.416c>u, p.Pro139Leu
Original code Subject 3 (Table 2)
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 09-Jun-2004 (Rel. 1, Created)
Date 09-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4534
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 454
Feature /codon: ccg -> ctg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 139
Feature /change: P -> L
Diagnosis Cyclic neutropenia
Sex XX
//
ID P139L(6); standard; MUTATION;
Accession E0121
Systematic name g.4534C>T, c.416C>T, r.416c>u, p.Pro139Leu
Original code No. 23
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4534
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 454
Feature /codon: ccg -> ctg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 139
Feature /change: P -> L
Diagnosis Cyclic neutropenia
Ethnic origin Caucasoid; France
//
ID P139L(7); standard; MUTATION;
Accession E0132
Systematic name g.4534C>T, c.416C>T, r.416c>u, p.Pro139Leu
Original code CyN 3
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 20-Oct-2005 (Rel. 1, Created)
Date 20-Oct-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16079102
RefAuthors Sera, Y., Kawaguchi, H., Nakamura, K., Sato, T., Habara,
RefAuthors M., Okada, S., Ishikawa, N., Kojima, S., Katoh, O.,
RefAuthors Kobayashi, M.
RefTitle A comparison of the defective granulopoiesis in childhood
RefTitle cyclic neutropenia and in severe congenital neutropenia.
RefLoc Haematologica 90:1032-1041 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4534
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 454
Feature /codon: ccg -> ctg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 139
Feature /change: P -> L
Diagnosis Cyclic neutropenia
Sex XY
//
ID C151S(1); standard; MUTATION;
Accession E0100
Systematic name g.4569T>A, c.451T>A, r.451u>a, p.Cys151Ser
Original code Patient 14
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 10-Jun-2004 (Rel. 1, Created)
Date 10-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11675333
RefAuthors Ancliff, P. J., Gale, R. E., Liesner, R., Hann, I. M.,
RefAuthors Linch, D. C.
RefTitle Mutations in the ELA2 gene encoding neutrophil elastase
RefTitle are present in most patients with sporadic severe
RefTitle congenital neutropenia but only in some patients with the
RefTitle familial form of the disease.
RefLoc Blood 98:2645-2650 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4569
Feature /change: t -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 489
Feature /codon: tgc -> agc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 151
Feature /change: C -> S
Diagnosis Congenital neutropenia
//
ID C151Y(1a); standard; MUTATION;
Accession E0104
Systematic name g.4570G>A, c.452G>A, r.452g>a, p.Cys151Tyr
Original code P1
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 14-Jun-2004 (Rel. 1, Created)
Date 14-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11722436
RefAuthors Germeshausen, M., Schulze, H., Ballmaier, M., Zeidler, C.,
RefAuthors Welte, K.
RefTitle Mutations in the gene encoding neutrophil elastase (ELA2)
RefTitle are not sufficient to cause the phenotype of congenital
RefTitle neutropenia.
RefLoc Br J Haematol 115:222-224 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4570
Feature /change: g -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 490
Feature /codon: tgc -> tac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 151
Feature /change: C -> Y
Diagnosis Congenital neutropenia
Family history Inherited
Relative ELA2base; E0105 sister
//
ID C151Y(1b); standard; MUTATION;
Accession E0105
Systematic name g.4570G>A, c.452G>A, r.452g>a, p.Cys151Tyr
Original code P2
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 14-Jun-2004 (Rel. 1, Created)
Date 14-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11722436
RefAuthors Germeshausen, M., Schulze, H., Ballmaier, M., Zeidler, C.,
RefAuthors Welte, K.
RefTitle Mutations in the gene encoding neutrophil elastase (ELA2)
RefTitle are not sufficient to cause the phenotype of congenital
RefTitle neutropenia.
RefLoc Br J Haematol 115:222-224 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4570
Feature /change: g -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 490
Feature /codon: tgc -> tac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 151
Feature /change: C -> Y
Diagnosis Congenital neutropenia
Family history Inherited
Relative ELA2base; E0104 brother
//
ID L152P(1); standard; MUTATION;
Accession E0122
Systematic name g.4573T>C, c.455T>C, r.455u>c, p.Leu152Pro
Original code No. 26
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4573
Feature /change: t -> c
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 493
Feature /codon: ctg -> ccg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 152
Feature /change: L -> P
Diagnosis Congenital neutropenia
Ethnic origin Caucasoid; France
//
ID A166T(1); standard; MUTATION;
Accession E0158
Systematic name g.4614G>A, c.496G>A, r.496g>a, p.Ala166Thr
Original code P1
Description A point mutation in the exon 4 leading to an amino acid
Description change
Date 04-Aug-2010 (Rel. 1, Created)
Date 04-Aug-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20220065
RefAuthors Germeshausen, M., Zeidler, C., Stuhrmann, M., Lanciotti,
RefAuthors M., Ballmaier, M., Welte, K.
RefTitle Digenic mutations in severe congenital neutropenia.
RefLoc Haematologica:1207-1210 (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: Y00477: 4614
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: M34379; GI:187116; HUMLEUELA: 534
Feature /codon: gcc -> acc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08246; ELNE_HUMAN: 166
Feature /change: A -> T
Diagnosis Congenital neutropenia
Symptoms Physical findings:
Symptoms Thrombocytopenia;
Symptoms Developmental delay; hypogonadotropic hypogonadism;
Symptoms Type II atrial septal defect;Mild mitral and tricuspid
Symptoms insufficiency; prominent superficial venous pattern;
Age 24
Sex XX
Ethnic origin Turkey
Comment Mutation is present also in the G6PC3 gene of the patient.
//
ID #V174-8(1); standard; MUTATION;
Accession E0081
Systematic name g.4638_4661delGTGACGGTGGTGACGTCCCTCTGC,
Systematic name c.520_543delGTGACGGTGGTGACGTCCCTCTGC,
Systematic name r.520_543delgugacgguggugacgucccucugc, p.Val174_Arg182del
Original code Subject 12
Description An inframe deletion in the exon 4 leading to truncation of
Description protein
Date 16-Oct-2003 (Rel. 1, Created)
Date 16-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0029: 4638..4661
Feature /change: -gtgacggtgg tgacgtccct ctgc
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 558..581
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 174..181
Feature /change: -VTVVTSLC
Diagnosis Congenital neutropenia
Sex XX
Family history Inherited
Comment Father is neutropenic and has myelodysplasia
//
ID G203D(1); standard; MUTATION;
Accession E0153
Systematic name g.4892G>A, c.608G>A, r.608g>a, p.Gly203Asp
Original code P.14
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18611981
RefAuthors Ishikawa, N., Okada, S., Miki, M., Shirao, K., Kihara, H.,
RefAuthors Tsumura, M., Nakamura, K., Kawaguchi, H., Ohtsubo, M.,
RefAuthors Yasunaga, S., Matsubara, K., Sako, M., Hara, J., Shiohara,
RefAuthors M., Kojima, S., Sato, T., Takihara, Y., Kobayashi, M.
RefTitle Neurodevelopmental abnormalities associated with severe
RefTitle congenital neutropenia due to the R86X mutation in the
RefTitle HAX1 gene.
RefLoc J Med Genet:802-807 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: Y00477: 4892
Feature /change: g -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: M34379; GI:187116; HUMLEUELA: 646
Feature /codon: ggc -> gac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08246; ELNE_HUMAN: 203
Feature /change: G -> D
Diagnosis Congenital neutropenia
Age 2 mo
Sex XY
Ethnic origin Japan
WBC 11.600 /ml
Neutrophil 0.232 /ml
Treatment Granulocyte colony stimulating factor
//
ID P205R(1); standard; MUTATION;
Accession E0101
Systematic name g.4898C>G, c.614C>G, r.614c>g, p.Pro205Arg
Original code Patient 15
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 10-Jun-2004 (Rel. 1, Created)
Date 10-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11675333
RefAuthors Ancliff, P. J., Gale, R. E., Liesner, R., Hann, I. M.,
RefAuthors Linch, D. C.
RefTitle Mutations in the ELA2 gene encoding neutrophil elastase
RefTitle are present in most patients with sporadic severe
RefTitle congenital neutropenia but only in some patients with the
RefTitle familial form of the disease.
RefLoc Blood 98:2645-2650 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4898
Feature /change: c -> g
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 652
Feature /codon: ccc -> cgc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 205
Feature /change: P -> R
Diagnosis Congenital neutropenia
//
ID L206F(1a); standard; MUTATION;
Accession E0010
Systematic name g.4902G>T, c.618G>T, r.618g>u, p.Leu206Phe
Original code Family 608
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 08-Oct-2003 (Rel. 1, Created)
Date 08-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4902
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 656
Feature /codon: ttg -> ttt; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 206
Feature /change: L -> F
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Relative ELA2base; E0011 son
Relative ELA2base; E0012 granddaughter
Relative ELA2base; E0013 grandson
Relative ELA2base; E0014 grand-granddaughter
Relative ELA2base; E0015 grand-granddaughter
//
ID L206F(1b); standard; MUTATION;
Accession E0011
Systematic name g.4902G>T, c.618G>T, r.618g>u, p.Leu206Phe
Original code Family 608
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 08-Oct-2003 (Rel. 1, Created)
Date 08-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4902
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 656
Feature /codon: ttg -> ttt; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 206
Feature /change: L -> F
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0010 mother
Relative ELA2base; E0012 daughter
Relative ELA2base; E0013 son
Relative ELA2base; E0014 granddaughter
Relative ELA2base; E0015 grandson
//
ID L206F(1c); standard; MUTATION;
Accession E0012
Systematic name g.4902G>T, c.618G>T, r.618g>u, p.Leu206Phe
Original code Family 608
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 08-Oct-2003 (Rel. 1, Created)
Date 08-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4902
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 656
Feature /codon: ttg -> ttt; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 206
Feature /change: L -> F
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0010 grandmother
Relative ELA2base; E0011 father
Relative ELA2base; E0013 half-brother
Relative ELA2base; E0014 daughter
Relative ELA2base; E0015 half-niece
//
ID L206F(1d); standard; MUTATION;
Accession E0013
Systematic name g.4902G>T, c.618G>T, r.618g>u, p.Leu206Phe
Original code Family 608
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 08-Oct-2003 (Rel. 1, Created)
Date 08-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4902
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 656
Feature /codon: ttg -> ttt; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 206
Feature /change: L -> F
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0010 grandmother
Relative ELA2base; E0011 father
Relative ELA2base; E0012 half-sister
Relative ELA2base; E0014 half-niece
Relative ELA2base; E0015 daughter
//
ID L206F(1e); standard; MUTATION;
Accession E0014
Systematic name g.4902G>T, c.618G>T, r.618g>u, p.Leu206Phe
Original code Family 608
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4902
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 656
Feature /codon: ttg -> ttt; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 206
Feature /change: L -> F
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0010 grand-grandmother
Relative ELA2base; E0011 grandfather
Relative ELA2base; E0012 mother
Relative ELA2base; E0013 half-uncle
Relative ELA2base; E0015 half-cousin
//
ID L206F(1f); standard; MUTATION;
Accession E0015
Systematic name g.4902G>T, c.618G>T, r.618g>u, p.Leu206Phe
Original code Family 608;14
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4902
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 656
Feature /codon: ttg -> ttt; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 206
Feature /change: L -> F
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0010 grand-grandmother
Relative ELA2base; E0011 grandfather
Relative ELA2base; E0012 half-aunt
Relative ELA2base; E0013 father
Relative ELA2base; E0014 half-cousin
//
ID L206F(2a); standard; MUTATION;
Accession E0016
Systematic name g.4902G>T, c.618G>T, r.618g>u, p.Leu206Phe
Original code Family 617
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4902
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 656
Feature /codon: ttg -> ttt; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 206
Feature /change: L -> F
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Relative ELA2base; E0017 daughter
Relative ELA2base; E0018 daughter
Relative ELA2base; E0019 son
//
ID L206F(2b); standard; MUTATION;
Accession E0017
Systematic name g.4902G>T, c.618G>T, r.618g>u, p.Leu206Phe
Original code Family 617
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4902
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 656
Feature /codon: ttg -> ttt; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 206
Feature /change: L -> F
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0016 mother
Relative ELA2base; E0018 sister
Relative ELA2base; E0019 half-brother
//
ID L206F(2c); standard; MUTATION;
Accession E0018
Systematic name g.4902G>T, c.618G>T, r.618g>u, p.Leu206Phe
Original code Family 617
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4902
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 656
Feature /codon: ttg -> ttt; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 206
Feature /change: L -> F
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0016 mother
Relative ELA2base; E0017 sister
Relative ELA2base; E0019 half-brother
//
ID L206F(2d); standard; MUTATION;
Accession E0019
Systematic name g.4902G>T, c.618G>T, r.618g>u, p.Leu206Phe
Original code Family 617
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4902
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 656
Feature /codon: ttg -> ttt; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 206
Feature /change: L -> F
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0016 mother
Relative ELA2base; E0017 half-sister
Relative ELA2base; E0018 half-sister
//
ID G210V(1); standard; MUTATION;
Accession E0082
Systematic name g.4913G>T, c.629G>T, r.629g>u, p.Gly210Val
Original code Subject 13
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 16-Oct-2003 (Rel. 1, Created)
Date 16-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4913
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 667
Feature /codon: ggg -> gtg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 210
Feature /change: G -> V
Diagnosis Congenital neutropenia
Sex XX
//
ID G214R(1); standard; MUTATION;
Accession E0083
Systematic name g.4924G>A, c.640G>A, r.640g>a, p.Gly214Arg
Original code Subject 14
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 16-Oct-2003 (Rel. 1, Created)
Date 16-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4924
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 678
Feature /codon: gga -> aga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 214
Feature /change: G -> R
Diagnosis Congenital neutropenia
Sex XX
//
ID G214R(2); standard; MUTATION;
Accession E0125
Systematic name g.4924G>A, c.640G>A, r.640g>a, p.Gly214Arg
Original code No. 36
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4924
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 678
Feature /codon: gga -> aga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 214
Feature /change: G -> R
Diagnosis Congenital neutropenia
Ethnic origin Caucasoid; France
//
ID G214R(3); standard; MUTATION;
Accession E0134
Systematic name g.4924G>A, c.640G>A, r.640g>a, p.Gly214Arg
Original code SCN 3 ref.[1]; P.11 ref.[2]
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 20-Oct-2005 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 16079102
RefAuthors Sera, Y., Kawaguchi, H., Nakamura, K., Sato, T., Habara,
RefAuthors M., Okada, S., Ishikawa, N., Kojima, S., Katoh, O.,
RefAuthors Kobayashi, M.
RefTitle A comparison of the defective granulopoiesis in childhood
RefTitle cyclic neutropenia and in severe congenital neutropenia.
RefLoc Haematologica 90:1032-1041 (2005)
RefNumber [2]
RefCrossRef PUBMED; 18611981
RefAuthors Ishikawa, N., Okada, S., Miki, M., Shirao, K., Kihara, H.,
RefAuthors Tsumura, M., Nakamura, K., Kawaguchi, H., Ohtsubo, M.,
RefAuthors Yasunaga, S., Matsubara, K., Sako, M., Hara, J., Shiohara,
RefAuthors M., Kojima, S., Sato, T., Takihara, Y., Kobayashi, M.
RefTitle Neurodevelopmental abnormalities associated with severe
RefTitle congenital neutropenia due to the R86X mutation in the
RefTitle HAX1 gene.
RefLoc J Med Genet:802-807 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4924
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 678
Feature /codon: gga -> aga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 214
Feature /change: G -> R
Diagnosis Congenital neutropenia
Age 1 mo
Sex XY
Ethnic origin Japan
WBC 8.600 /ml
Neutrophil 0 /ml
Treatment Stem cell transplants
//
ID G214R(4); standard; MUTATION;
Accession E0145
Systematic name g.4924G>A, c.640G>A, r.640g>a, p.Gly214Arg
Original code P1
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 02-May-2008 (Rel. 1, Created)
Date 02-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17311988
RefAuthors Donini, M., Fontana, S., Savoldi, G., Vermi, W., Tassone,
RefAuthors L., Gentili, F., Zenaro, E., Ferrari, D., Notarangelo, L.
RefAuthors D., Porta, F., Facchetti, F., Notarangelo, L. D., Dusi,
RefAuthors S., Badolato, R.
RefTitle G-CSF treatment of severe congenital neutropenia reverses
RefTitle neutropenia but does not correct the underlying functional
RefTitle deficiency of the neutrophil in defending against
RefTitle microorganisms.
RefLoc Blood:4716-4723 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: Y00477: 4924
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: M34379; GI:187116; HUMLEUELA: 678
Feature /codon: gga -> aga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08246; ELNE_HUMAN: 214
Feature /change: G -> R
Diagnosis Congenital neutropenia
Age 0,2
Ethnic origin Italy
//
ID G214R(5); standard; MUTATION;
Accession E0146
Systematic name g.4924G>A, c.640G>A, r.640g>a, p.Gly214Arg
Original code P2
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 02-May-2008 (Rel. 1, Created)
Date 02-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17311988
RefAuthors Donini, M., Fontana, S., Savoldi, G., Vermi, W., Tassone,
RefAuthors L., Gentili, F., Zenaro, E., Ferrari, D., Notarangelo, L.
RefAuthors D., Porta, F., Facchetti, F., Notarangelo, L. D., Dusi,
RefAuthors S., Badolato, R.
RefTitle G-CSF treatment of severe congenital neutropenia reverses
RefTitle neutropenia but does not correct the underlying functional
RefTitle deficiency of the neutrophil in defending against
RefTitle microorganisms.
RefLoc Blood:4716-4723 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: Y00477: 4924
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: M34379; GI:187116; HUMLEUELA: 678
Feature /codon: gga -> aga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08246; ELNE_HUMAN: 214
Feature /change: G -> R
Diagnosis Congenital neutropenia
Age 0,01
Ethnic origin Italy
//
ID V219I(1); standard; MUTATION;
Accession E0126
Systematic name g.4939G>A, c.655G>A, r.655g>a, p.Val219Ile
Original code No. 37
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4939
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 693
Feature /codon: gtc -> atc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 219
Feature /change: V -> I
Diagnosis Cyclic neutropenia
Ethnic origin Caucasoid; France
//
ID R220Q(1a); standard; MUTATION;
Accession E0020
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code Family 613
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Relative ELA2base; E0021 son
//
ID R220Q(1b); standard; MUTATION;
Accession E0021
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code Family 613;5
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0020 mother
//
ID R220Q(2a); standard; MUTATION;
Accession E0022
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code Family 619
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Relative ELA2base; E0023 son
Relative ELA2base; E0024 son
Relative ELA2base; E0025 daughter
Relative ELA2base; E0026 daughter
Relative ELA2base; E0027 son
Relative ELA2base; E0028 grandson
Relative ELA2base; E0029 grandson
Relative ELA2base; E0030 grandson
Relative ELA2base; E0031 granddaughter
Relative ELA2base; E0032 grandson
Relative ELA2base; E0033 grandson
//
ID R220Q(2b); standard; MUTATION;
Accession E0023
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code Family 619
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0022 mother
Relative ELA2base; E0024 brother
Relative ELA2base; E0025 sister
Relative ELA2base; E0026 sister
Relative ELA2base; E0027 brother
Relative ELA2base; E0028 son
Relative ELA2base; E0029 son
Relative ELA2base; E0030 son
Relative ELA2base; E0031 niece
Relative ELA2base; E0032 nephew
Relative ELA2base; E0033 nephew
//
ID R220Q(2c); standard; MUTATION;
Accession E0024
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code Family 619
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0022 mother
Relative ELA2base; E0023 brother
Relative ELA2base; E0025 sister
Relative ELA2base; E0026 sister
Relative ELA2base; E0027 brother
Relative ELA2base; E0028 nephew
Relative ELA2base; E0029 nephew
Relative ELA2base; E0030 nephew
Relative ELA2base; E0031 daughter
Relative ELA2base; E0032 nephew
Relative ELA2base; E0033 nephew
//
ID R220Q(2d); standard; MUTATION;
Accession E0025
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code Family 619
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0022 mother
Relative ELA2base; E0023 brother
Relative ELA2base; E0024 brother
Relative ELA2base; E0026 sister
Relative ELA2base; E0027 brother
Relative ELA2base; E0028 nephew
Relative ELA2base; E0029 nephew
Relative ELA2base; E0030 nephew
Relative ELA2base; E0031 niece
Relative ELA2base; E0032 nephew
Relative ELA2base; E0033 nephew
//
ID R220Q(2e); standard; MUTATION;
Accession E0026
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code Family 619;11
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0022 mother
Relative ELA2base; E0023 brother
Relative ELA2base; E0024 brother
Relative ELA2base; E0025 sister
Relative ELA2base; E0027 brother
Relative ELA2base; E0028 nephew
Relative ELA2base; E0029 nephew
Relative ELA2base; E0030 nephew
Relative ELA2base; E0031 niece
Relative ELA2base; E0032 son
Relative ELA2base; E0033 nephew
//
ID R220Q(2f); standard; MUTATION;
Accession E0027
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code Family 619
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0022 mother
Relative ELA2base; E0023 brother
Relative ELA2base; E0024 brother
Relative ELA2base; E0025 sister
Relative ELA2base; E0026 sister
Relative ELA2base; E0028 nephew
Relative ELA2base; E0029 nephew
Relative ELA2base; E0030 nephew
Relative ELA2base; E0031 niece
Relative ELA2base; E0032 nephew
Relative ELA2base; E0033 son
//
ID R220Q(2g); standard; MUTATION;
Accession E0028
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code Family 619
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0022 grandmother
Relative ELA2base; E0023 father
Relative ELA2base; E0024 uncle
Relative ELA2base; E0025 aunt
Relative ELA2base; E0026 aunt
Relative ELA2base; E0027 uncle
Relative ELA2base; E0029 brother
Relative ELA2base; E0030 brother
Relative ELA2base; E0031 cousin
Relative ELA2base; E0032 cousin
Relative ELA2base; E0033 cousin
//
ID R220Q(2h); standard; MUTATION;
Accession E0029
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code Family 619
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0022 grandmother
Relative ELA2base; E0023 father
Relative ELA2base; E0024 uncle
Relative ELA2base; E0025 aunt
Relative ELA2base; E0026 aunt
Relative ELA2base; E0027 uncle
Relative ELA2base; E0028 brother
Relative ELA2base; E0030 brother
Relative ELA2base; E0031 cousin
Relative ELA2base; E0032 cousin
Relative ELA2base; E0033 cousin
//
ID R220Q(2i); standard; MUTATION;
Accession E0030
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code Family 619
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0022 grandmother
Relative ELA2base; E0023 father
Relative ELA2base; E0024 uncle
Relative ELA2base; E0025 aunt
Relative ELA2base; E0026 aunt
Relative ELA2base; E0027 uncle
Relative ELA2base; E0028 brother
Relative ELA2base; E0029 brother
Relative ELA2base; E0031 cousin
Relative ELA2base; E0032 cousin
Relative ELA2base; E0033 cousin
//
ID R220Q(2j); standard; MUTATION;
Accession E0031
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code Family 619
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0022 grandmother
Relative ELA2base; E0023 uncle
Relative ELA2base; E0024 father
Relative ELA2base; E0025 aunt
Relative ELA2base; E0026 aunt
Relative ELA2base; E0027 uncle
Relative ELA2base; E0028 cousin
Relative ELA2base; E0029 cousin
Relative ELA2base; E0030 cousin
Relative ELA2base; E0032 cousin
Relative ELA2base; E0033 cousin
//
ID R220Q(2k); standard; MUTATION;
Accession E0032
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code Family 619
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0022 grandmother
Relative ELA2base; E0023 uncle
Relative ELA2base; E0024 uncle
Relative ELA2base; E0025 aunt
Relative ELA2base; E0026 mother
Relative ELA2base; E0027 uncle
Relative ELA2base; E0028 cousin
Relative ELA2base; E0029 cousin
Relative ELA2base; E0030 cousin
Relative ELA2base; E0031 cousin
Relative ELA2base; E0033 cousin
//
ID R220Q(2l); standard; MUTATION;
Accession E0033
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code Family 619
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0022 grandmother
Relative ELA2base; E0023 uncle
Relative ELA2base; E0024 uncle
Relative ELA2base; E0025 aunt
Relative ELA2base; E0026 aunt
Relative ELA2base; E0027 father
Relative ELA2base; E0028 cousin
Relative ELA2base; E0029 cousin
Relative ELA2base; E0030 cousin
Relative ELA2base; E0031 cousin
Relative ELA2base; E0032 cousin
//
ID R220Q(3a); standard; MUTATION;
Accession E0034
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code Family 622
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Relative ELA2base; E0035 daughter
Relative ELA2base; E0036 son
Relative ELA2base; E0037 daughter
Relative ELA2base; E0038 daughter
Relative ELA2base; E0039 granddaughter
Relative ELA2base; E0040 granddaughter
//
ID R220Q(3b); standard; MUTATION;
Accession E0035
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code Family 622
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0034 father
Relative ELA2base; E0036 brother
Relative ELA2base; E0037 sister
Relative ELA2base; E0038 sister
Relative ELA2base; E0039 niece
Relative ELA2base; E0040 niece
//
ID R220Q(3c); standard; MUTATION;
Accession E0036
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code Family 622
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0034 father
Relative ELA2base; E0035 sister
Relative ELA2base; E0037 sister
Relative ELA2base; E0038 sister
Relative ELA2base; E0039 niece
Relative ELA2base; E0040 niece
//
ID R220Q(3d); standard; MUTATION;
Accession E0037
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code Family 622;10
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0034 father
Relative ELA2base; E0035 sister
Relative ELA2base; E0036 brother
Relative ELA2base; E0038 sister
Relative ELA2base; E0039 daughter
Relative ELA2base; E0040 daughter
//
ID R220Q(3e); standard; MUTATION;
Accession E0038
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code Family 622
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0034 father
Relative ELA2base; E0035 sister
Relative ELA2base; E0036 brother
Relative ELA2base; E0037 sister
Relative ELA2base; E0039 niece
Relative ELA2base; E0040 niece
//
ID R220Q(3f); standard; MUTATION;
Accession E0039
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code Family 622
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0034 grandfather
Relative ELA2base; E0035 aunt
Relative ELA2base; E0036 uncle
Relative ELA2base; E0037 mother
Relative ELA2base; E0038 aunt
Relative ELA2base; E0040 sister
//
ID R220Q(3g); standard; MUTATION;
Accession E0040
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code Family 622
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0034 grandfather
Relative ELA2base; E0035 aunt
Relative ELA2base; E0036 uncle
Relative ELA2base; E0037 mother
Relative ELA2base; E0038 aunt
Relative ELA2base; E0039 sister
//
ID R220Q(4); standard; MUTATION;
Accession E0130
Systematic name g.4943G>A, c.659G>A, r.659g>a, p.Arg220Gln
Original code CyN 1
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 20-Oct-2005 (Rel. 1, Created)
Date 20-Oct-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16079102
RefAuthors Sera, Y., Kawaguchi, H., Nakamura, K., Sato, T., Habara,
RefAuthors M., Okada, S., Ishikawa, N., Kojima, S., Katoh, O.,
RefAuthors Kobayashi, M.
RefTitle A comparison of the defective granulopoiesis in childhood
RefTitle cyclic neutropenia and in severe congenital neutropenia.
RefLoc Haematologica 90:1032-1041 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4943
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 697
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 220
Feature /change: R -> Q
Diagnosis Cyclic neutropenia
Sex XY
//
ID G221X(1); standard; MUTATION;
Accession E0084
Systematic name g.4945G>T, c.661G>T, r.661g>u, p.Gly221X
Original code Subject 15
Description A point mutation in the exon 5 leading to a premature stop
Description codon
Date 16-Oct-2003 (Rel. 1, Created)
Date 16-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4945
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0029: 699
Feature /codon: gga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08246; ELNE_HUMAN: 221
Feature /change: G -> X
Diagnosis Congenital neutropenia
Sex XY
//
ID C223X(1); standard; MUTATION;
Accession E0127
Systematic name g.4953C>A, c.669C>A, r.669c>a, p.Cys223X
Original code No. 40
Description A point mutation in the exon 5 leading to a premature stop
Description codon
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4953
Feature /change: c -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0029: 707
Feature /codon: tgc -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08246; ELNE_HUMAN: 223
Feature /change: C -> X
Diagnosis Congenital neutropenia
Ethnic origin Caucasoid; France
//
ID C223X(2); standard; MUTATION;
Accession E0133
Systematic name g.4953C>A, c.669C>A, r.669c>a, p.Cys223X
Original code SCN 1 ref.[1]; P.16 ref.[2]
Description A point mutation in the exon 5 leading to a premature stop
Description codon
Date 20-Oct-2005 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 16079102
RefAuthors Sera, Y., Kawaguchi, H., Nakamura, K., Sato, T., Habara,
RefAuthors M., Okada, S., Ishikawa, N., Kojima, S., Katoh, O.,
RefAuthors Kobayashi, M.
RefTitle A comparison of the defective granulopoiesis in childhood
RefTitle cyclic neutropenia and in severe congenital neutropenia.
RefLoc Haematologica 90:1032-1041 (2005)
RefNumber [2]
RefCrossRef PUBMED; 18611981
RefAuthors Ishikawa, N., Okada, S., Miki, M., Shirao, K., Kihara, H.,
RefAuthors Tsumura, M., Nakamura, K., Kawaguchi, H., Ohtsubo, M.,
RefAuthors Yasunaga, S., Matsubara, K., Sako, M., Hara, J., Shiohara,
RefAuthors M., Kojima, S., Sato, T., Takihara, Y., Kobayashi, M.
RefTitle Neurodevelopmental abnormalities associated with severe
RefTitle congenital neutropenia due to the R86X mutation in the
RefTitle HAX1 gene.
RefLoc J Med Genet:802-807 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4953
Feature /change: c -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0029: 707
Feature /codon: tgc -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08246; ELNE_HUMAN: 223
Feature /change: C -> X
Diagnosis Congenital neutropenia
Age 6 mo
Sex XY
Ethnic origin Japan
WBC 10.700 /ml
Neutrophil 0 /ml
Treatment Granulocyte colony stimulating factor
//
ID C223X(3); standard; MUTATION;
Accession E0155
Systematic name g.4953C>A, c.669C>A, r.669c>a, p.Cys223X
Original code P.6
Description A point mutation in the exon 5 leading to a premature stop
Description codon
Date 21-Jul-2010 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18611981
RefAuthors Ishikawa, N., Okada, S., Miki, M., Shirao, K., Kihara, H.,
RefAuthors Tsumura, M., Nakamura, K., Kawaguchi, H., Ohtsubo, M.,
RefAuthors Yasunaga, S., Matsubara, K., Sako, M., Hara, J., Shiohara,
RefAuthors M., Kojima, S., Sato, T., Takihara, Y., Kobayashi, M.
RefTitle Neurodevelopmental abnormalities associated with severe
RefTitle congenital neutropenia due to the R86X mutation in the
RefTitle HAX1 gene.
RefLoc J Med Genet:802-807 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: Y00477: 4953
Feature /change: c -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: EMBL: M34379; GI:187116; HUMLEUELA: 707
Feature /codon: tgc -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: SWISSPROT: P08246; ELNE_HUMAN: 223
Feature /change: C -> X
Diagnosis Congenital neutropenia
Age 6 mo
Sex XY
Ethnic origin Japan
WBC 12.000 /ml
Neutrophil 0.120 /ml
Treatment Granulocyte colony stimulating factor
//
ID S225X(1); standard; MUTATION;
Accession E0085
Systematic name g.4958C>A, c.674C>A, r.674c>a, p.Ser225X
Original code Subject 16
Description A point mutation in the exon 5 leading to a premature stop
Description codon
Date 16-Oct-2003 (Rel. 1, Created)
Date 16-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4958
Feature /change: c -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0029: 712
Feature /codon: tca -> taa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08246; ELNE_HUMAN: 225
Feature /change: S -> X
Diagnosis Congenital neutropenia
Sex XY
//
ID Y228X(1); standard; MUTATION;
Accession E0086
Systematic name g.4968C>A, c.684C>A, r.684c>a, p.Tyr228X
Original code Subject 17
Description A point mutation in the exon 5 leading to a premature stop
Description codon
Date 16-Oct-2003 (Rel. 1, Created)
Date 16-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4968
Feature /change: c -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0029: 722
Feature /codon: tac -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08246; ELNE_HUMAN: 228
Feature /change: Y -> X
Diagnosis Congenital neutropenia
Sex XY
//
ID #D230X239(1); standard; MUTATION;
Accession E0128
Systematic name g.4972delG, c.688delG, r.688delg, p.Asp230fsX10
Original code No. 44
Description A frame shift deletion mutation in the exon 5 leading to a
Description premature stop codon
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0029: 4972
Feature /change: -g
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0029: 726
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08246; ELNE_HUMAN: 230
Feature /change: D -> MPLPRWHSLX
Diagnosis Congenital neutropenia
Ethnic origin Caucasoid; France
//
ID A233P(1); standard; MUTATION;
Accession E0135
Systematic name g.4981G>C, c.697G>C, r.697g>c, p.Ala233Pro
Original code SCN 4 ref.[1]; P.7 ref.[2]
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 20-Oct-2005 (Rel. 1, Created)
Date 21-Jul-2010 (Rel. 1, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 16079102
RefAuthors Sera, Y., Kawaguchi, H., Nakamura, K., Sato, T., Habara,
RefAuthors M., Okada, S., Ishikawa, N., Kojima, S., Katoh, O.,
RefAuthors Kobayashi, M.
RefTitle A comparison of the defective granulopoiesis in childhood
RefTitle cyclic neutropenia and in severe congenital neutropenia.
RefLoc Haematologica 90:1032-1041 (2005)
RefNumber [2]
RefCrossRef PUBMED; 18611981
RefAuthors Ishikawa, N., Okada, S., Miki, M., Shirao, K., Kihara, H.,
RefAuthors Tsumura, M., Nakamura, K., Kawaguchi, H., Ohtsubo, M.,
RefAuthors Yasunaga, S., Matsubara, K., Sako, M., Hara, J., Shiohara,
RefAuthors M., Kojima, S., Sato, T., Takihara, Y., Kobayashi, M.
RefTitle Neurodevelopmental abnormalities associated with severe
RefTitle congenital neutropenia due to the R86X mutation in the
RefTitle HAX1 gene.
RefLoc J Med Genet:802-807 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4981
Feature /change: g -> c
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 735
Feature /codon: gcc -> ccc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 233
Feature /change: A -> P
Diagnosis Congenital neutropenia
Age 1 mo
Sex XY
Ethnic origin Japan
WBC 11.500 /ml
Neutrophil 0.375 /ml
Treatment Granulocyte colony stimulating factor
//
ID P257L(1); standard; MUTATION;
Accession E0102
Systematic name g.5054C>T, c.770C>T, r.770c>u, p.Pro257Leu
Original code Patient 16
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 10-Jun-2004 (Rel. 1, Created)
Date 10-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11675333
RefAuthors Ancliff, P. J., Gale, R. E., Liesner, R., Hann, I. M.,
RefAuthors Linch, D. C.
RefTitle Mutations in the ELA2 gene encoding neutrophil elastase
RefTitle are present in most patients with sporadic severe
RefTitle congenital neutropenia but only in some patients with the
RefTitle familial form of the disease.
RefLoc Blood 98:2645-2650 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 5054
Feature /change: c -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 808
Feature /codon: ccc -> ctc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 257
Feature /change: P -> L
Diagnosis Congenital neutropenia
//
ID P262L(1); standard; MUTATION;
Accession E0129
Systematic name g.5069C>T, c.785C>T, r.785c>u, p.Pro262Leu
Original code No. 47
Description A point mutation in the exon 5 leading to an amino acid
Description change
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 5069
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0029: 823
Feature /codon: ccg -> ctg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08246; ELNE_HUMAN: 262
Feature /change: P -> L
Diagnosis Cyclic neutropenia
Ethnic origin Caucasoid; France
//
ID Upstream(1); standard; MUTATION;
Accession E0108
Systematic name g.c.r.
Original code No. 1
Description A point mutation in the promoter region 3 bp to upstream
Description from cDNA start point
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1246
Feature /change: c -> a
Feature /genomic_region: 5' UTR
Feature /genomic_region: promoter
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: upstream
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Congenital neutropenia
Ethnic origin Caucasoid; France
//
ID Upstream(2a); standard; MUTATION;
Accession E0142
Systematic name g.c.r.
Original code 46-year-old woman
Description Point mutation in the promoter region 186 bp to upstream
Description from cDNA start point
Date 23-Feb-2007 (Rel. 1, Created)
Date 23-Feb-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16795059
RefAuthors Matsushita, H., Asai, S., Komiya, S., Inoue, H., Yabe, H.,
RefAuthors Miyachi, H.
RefTitle A family of severe congenital neutropenia with -199C to A
RefTitle substitution in ELA2 promoter.
RefLoc Am J Hematol:985-986 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1063
Feature /change: c -> a
Feature /genomic_region: promoter
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: upstream
Feature /inexloc: -186
Feature aa; 3
Feature /rnalink: 2
Feature /name: no translation
Diagnosis Congenital neutropenia
Symptoms Other symptoms:
Symptoms recurring life-threatenig infections in the childhood,
Symptoms but only mild upper respiratory infections after
Symptoms adulthood
Sex XX
Relative ELA2base; E0143; daughter
Relative ELA2base; E0144; daughter
Comment The substitution has also been reported in normal subjects
Comment and may not be sufficient to cause SCN alone
//
ID Upstream(2b); standard; MUTATION;
Accession E0143
Systematic name g.c.r.
Original code Daughter 1
Description Point mutation in the promoter region 186 bp to upstream
Description from cDNA start point
Date 23-Feb-2007 (Rel. 1, Created)
Date 23-Feb-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16795059
RefAuthors Matsushita, H., Asai, S., Komiya, S., Inoue, H., Yabe, H.,
RefAuthors Miyachi, H.
RefTitle A family of severe congenital neutropenia with -199C to A
RefTitle substitution in ELA2 promoter.
RefLoc Am J Hematol:985-986 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1063
Feature /change: c -> a
Feature /genomic_region: promoter
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: upstream
Feature /inexloc: -186
Feature aa; 3
Feature /rnalink: 2
Feature /name: no translation
Diagnosis Congenital neutropenia
Symptoms Other symptoms:
Symptoms neutropenia since her childhood, but not any severe
Symptoms infections
Age 20
Sex XX
Relative ELA2base; E0142; mother
Relative ELA2base; E0144; sister
Comment The substitution has also been reported in normal subjects
Comment and may not be sufficient to cause SCN alone
//
ID Upstream(2c); standard; MUTATION;
Accession E0144
Systematic name g.c.r.
Original code Daughter 2
Description Point mutation in the promoter region 186 bp to upstream
Description from cDNA start point
Date 23-Feb-2007 (Rel. 1, Created)
Date 23-Feb-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16795059
RefAuthors Matsushita, H., Asai, S., Komiya, S., Inoue, H., Yabe, H.,
RefAuthors Miyachi, H.
RefTitle A family of severe congenital neutropenia with -199C to A
RefTitle substitution in ELA2 promoter.
RefLoc Am J Hematol:985-986 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 1063
Feature /change: c -> a
Feature /genomic_region: promoter
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: upstream
Feature /inexloc: -186
Feature aa; 3
Feature /rnalink: 2
Feature /name: no translation
Diagnosis Congenital neutropenia
Symptoms Infections:
Symptoms Sepsis;
Symptoms Other symptoms:
Symptoms SCN diagnosed in her babyhood and she often suffered
Symptoms from recurrent severe infections requiring G-CSF
Symptoms administration
Age 16
Sex XX
Relative ELA2base; E0142; mother
Relative ELA2base; E0143; sister
Comment The substitution has also been reported in normal subjects
Comment and may not be sufficient to cause SCN alone
//
ID Intron 3(1); standard; MUTATION;
Accession E0088
Systematic name g.IVS3-8C>A, c.367-8C>A, r.367-8c>a,
Original code Subject 20
Description A point mutation in the intron 3 leading to cryptic
Description splice acceptor site activation
Date 09-Jun-2004 (Rel. 1, Created)
Date 09-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4477
Feature /change: c -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe insertion
Feature /loc: IDRefSeq: C0029: 405
Feature /change: +ccacag
Feature /inexloc: -8
Feature aa; 3
Feature /rnalink: 2
Feature /name: insertion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 123
Feature /change: +PQ
Diagnosis Congenital neutropenia
Symptoms Physical findings:
Symptoms Acute myeloid leukemia
Sex XY
//
ID Intron 3(2); standard; MUTATION;
Accession E0097
Systematic name g.IVS3-8C>A, c.367-8C>A, r.367-8c>a,
Original code Patient 11
Description A point mutation in the intron 3 leading to an aberrant
Description splicing
Date 10-Jun-2004 (Rel. 1, Created)
Date 10-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11675333
RefAuthors Ancliff, P. J., Gale, R. E., Liesner, R., Hann, I. M.,
RefAuthors Linch, D. C.
RefTitle Mutations in the ELA2 gene encoding neutrophil elastase
RefTitle are present in most patients with sporadic severe
RefTitle congenital neutropenia but only in some patients with the
RefTitle familial form of the disease.
RefLoc Blood 98:2645-2650 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4477
Feature /change: c -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -8
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Congenital neutropenia
//
ID Intron 4(1a); standard; MUTATION;
Accession E0041
Systematic name g.IVS4+1G>A, c.597+1G>A, r.597+1g>a,
Original code Family 602
Description A point mutation in the intron 4 leading to an inframe
Description deletion of the last 10 residues from exon 4
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4716
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Relative ELA2base; E0042 daughter
Relative ELA2base; E0043 daughter
Relative ELA2base; E0044 grandson
//
ID Intron 4(1b); standard; MUTATION;
Accession E0042
Systematic name g.IVS4+1G>A, c.597+1G>A, r.597+1g>a,
Original code Family 602;3
Description A point mutation in the intron 4 leading to an inframe
Description deletion of the last 10 residues from exon 4
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4716
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0041 father
Relative ELA2base; E0043 sister
Relative ELA2base; E0044 nephew
//
ID Intron 4(1c); standard; MUTATION;
Accession E0043
Systematic name g.IVS4+1G>A, c.597+1G>A, r.597+1g>a,
Original code Family 602
Description A point mutation in the intron 4 leading to an inframe
Description deletion of the last 10 residues from exon 4
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4716
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0041 father
Relative ELA2base; E0042 sister
Relative ELA2base; E0044 son
//
ID Intron 4(1d); standard; MUTATION;
Accession E0044
Systematic name g.IVS4+1G>A, c.597+1G>A, r.597+1g>a,
Original code Family 602;7
Description A point mutation in the intron 4 leading to an inframe
Description deletion of the last 10 residues from exon 4
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4716
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0041 grandfather
Relative ELA2base; E0042 aunt
Relative ELA2base; E0043 mother
//
ID Intron 4(2a); standard; MUTATION;
Accession E0045
Systematic name g.IVS4+1G>A, c.597+1G>A, r.597+1g>a,
Original code Family 605
Description A point mutation in the intron 4 leading to an inframe
Description deletion of the last 10 residues from exon 4
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4716
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Relative ELA2base; E0046 son
//
ID Intron 4(2b); standard; MUTATION;
Accession E0046
Systematic name g.IVS4+1G>A, c.597+1G>A, r.597+1g>a,
Original code Family 605
Description A point mutation in the intron 4 leading to an inframe
Description deletion of the last 10 residues from exon 4
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4716
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0045 mother
//
ID Intron 4(3); standard; MUTATION;
Accession E0047
Systematic name g.IVS4+1G>A, c.597+1G>A, r.597+1g>a,
Original code Patient X1
Description A point mutation in the intron 4 leading to an inframe
Description deletion of the last 10 residues from exon 4
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4716
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Diagnosis Cyclic neutropenia
Family history De novo
//
ID Intron 4(4a); standard; MUTATION;
Accession E0048
Systematic name g.IVS4+3A>T, c.597+3A>T, r.597+3a>u,
Original code Family 603
Description A point mutation in the intron 4 creates a putative
Description cryptic splice-donor site leading to aberrant splicing
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4718
Feature /change: a -> t
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +3
Feature /note: putative deletion of the last 30 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 10 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Relative ELA2base; E0049 son
Relative ELA2base; E0050 son
Relative ELA2base; E0051 grandson
//
ID Intron 4(4b); standard; MUTATION;
Accession E0049
Systematic name g.IVS4+3A>T, c.597+3A>T, r.597+3a>u,
Original code Family 603
Description A point mutation in the intron 4 creates a putative
Description cryptic splice-donor site leading to aberrant splicing
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4718
Feature /change: a -> t
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +3
Feature /note: putative deletion of the last 30 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 10 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0048 father
Relative ELA2base; E0050 brother
Relative ELA2base; E0051 nephew
//
ID Intron 4(4c); standard; MUTATION;
Accession E0050
Systematic name g.IVS4+3A>T, c.597+3A>T, r.597+3a>u,
Original code Family 603
Description A point mutation in the intron 4 creates a putative
Description cryptic splice-donor site leading to aberrant splicing
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4718
Feature /change: a -> t
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +3
Feature /note: putative deletion of the last 30 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 10 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0048 father
Relative ELA2base; E0049 brother
Relative ELA2base; E0051 son
//
ID Intron 4(4d); standard; MUTATION;
Accession E0051
Systematic name g.IVS4+3A>T, c.597+3A>T, r.597+3a>u,
Original code Family 603;7
Description A point mutation in the intron 4 creates a putative
Description cryptic splice-donor site leading to aberrant splicing
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4718
Feature /change: a -> t
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +3
Feature /note: putative deletion of the last 30 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 10 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0048 grandfather
Relative ELA2base; E0049 uncle
Relative ELA2base; E0050 father
//
ID Intron 4(5a); standard; MUTATION;
Accession E0052
Systematic name g.IVS4+5G>A, c.597+5G>A, r.597+5g>a,
Original code Family 601
Description A point mutation in the intron 4 creates a putative
Description cryptic splice-donor site leading to aberrant splicing
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4720
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +5
Feature /note: putative deletion of the last 30 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 10 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XX
Relative ELA2base; E0053 son
Relative ELA2base; E0054 son
Relative ELA2base; E0055 daughter
Relative ELA2base; E0056 granddaughter
Relative ELA2base; E0057 granddaughter
Relative ELA2base; E0058 granddaughter
Relative ELA2base; E0059 grand-grandson
Relative ELA2base; E0060 grand-granddaughter
//
ID Intron 4(5b); standard; MUTATION;
Accession E0053
Systematic name g.IVS4+5G>A, c.597+5G>A, r.597+5g>a,
Original code Family 601
Description A point mutation in the intron 4 creates a putative
Description cryptic splice-donor site leading to aberrant splicing
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4720
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +5
Feature /note: putative deletion of the last 30 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 10 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XY
Family history Inherited
Relative ELA2base; E0052 mother
Relative ELA2base; E0054 brother
Relative ELA2base; E0055 sister
Relative ELA2base; E0056 daughter
Relative ELA2base; E0057 daughter
Relative ELA2base; E0058 niece
Relative ELA2base; E0059 niece's son
Relative ELA2base; E0060 niece's daughter
//
ID Intron 4(5c); standard; MUTATION;
Accession E0054
Systematic name g.IVS4+5G>A, c.597+5G>A, r.597+5g>a,
Original code Family 601
Description A point mutation in the intron 4 creates a putative
Description cryptic splice-donor site leading to aberrant splicing
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4720
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +5
Feature /note: putative deletion of the last 30 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 10 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XY
Family history Inherited
Relative ELA2base; E0052 mother
Relative ELA2base; E0053 brother
Relative ELA2base; E0055 sister
Relative ELA2base; E0056 niece
Relative ELA2base; E0057 niece
Relative ELA2base; E0058 niece
Relative ELA2base; E0059 niece's son
Relative ELA2base; E0060 niece's daughter
//
ID Intron 4(5d); standard; MUTATION;
Accession E0055
Systematic name g.IVS4+5G>A, c.597+5G>A, r.597+5g>a,
Original code Family 601
Description A point mutation in the intron 4 creates a putative
Description cryptic splice-donor site leading to aberrant splicing
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4720
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +5
Feature /note: putative deletion of the last 30 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 10 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XX
Family history Inherited
Relative ELA2base; E0052 mother
Relative ELA2base; E0053 brother
Relative ELA2base; E0054 brother
Relative ELA2base; E0056 niece
Relative ELA2base; E0057 niece
Relative ELA2base; E0058 daughter
Relative ELA2base; E0059 grandson
Relative ELA2base; E0060 granddaughter
//
ID Intron 4(5e); standard; MUTATION;
Accession E0056
Systematic name g.IVS4+5G>A, c.597+5G>A, r.597+5g>a,
Original code Family 601
Description A point mutation in the intron 4 creates a putative
Description cryptic splice-donor site leading to aberrant splicing
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4720
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +5
Feature /note: putative deletion of the last 30 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 10 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XX
Family history Inherited
Relative ELA2base; E0052 grandmother
Relative ELA2base; E0053 father
Relative ELA2base; E0054 uncle
Relative ELA2base; E0055 aunt
Relative ELA2base; E0057 sister
Relative ELA2base; E0058 cousin
Relative ELA2base; E0059 cousin's son
Relative ELA2base; E0060 cousin's daughter
//
ID Intron 4(5f); standard; MUTATION;
Accession E0057
Systematic name g.IVS4+5G>A, c.597+5G>A, r.597+5g>a,
Original code Family 601
Description A point mutation in the intron 4 creates a putative
Description cryptic splice-donor site leading to aberrant splicing
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4720
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +5
Feature /note: putative deletion of the last 30 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 10 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XX
Family history Inherited
Relative ELA2base; E0052 grandmother
Relative ELA2base; E0053 father
Relative ELA2base; E0054 uncle
Relative ELA2base; E0055 aunt
Relative ELA2base; E0056 sister
Relative ELA2base; E0058 cousin
Relative ELA2base; E0059 cousin's son
Relative ELA2base; E0060 cousin's daughter
//
ID Intron 4(5g); standard; MUTATION;
Accession E0058
Systematic name g.IVS4+5G>A, c.597+5G>A, r.597+5g>a,
Original code Family 601
Description A point mutation in the intron 4 creates a putative
Description cryptic splice-donor site leading to aberrant splicing
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4720
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +5
Feature /note: putative deletion of the last 30 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 10 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XX
Family history Inherited
Relative ELA2base; E0052 grandmother
Relative ELA2base; E0053 uncle
Relative ELA2base; E0054 uncle
Relative ELA2base; E0055 mother
Relative ELA2base; E0056 cousin
Relative ELA2base; E0057 cousin
Relative ELA2base; E0059 son
Relative ELA2base; E0060 daughter
//
ID Intron 4(5h); standard; MUTATION;
Accession E0059
Systematic name g.IVS4+5G>A, c.597+5G>A, r.597+5g>a,
Original code Family 601
Description A point mutation in the intron 4 creates a putative
Description cryptic splice-donor site leading to aberrant splicing
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4720
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +5
Feature /note: putative deletion of the last 30 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 10 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XY
Family history Inherited
Relative ELA2base; E0052 grand-grandmother
Relative ELA2base; E0053 granduncle
Relative ELA2base; E0054 granduncle
Relative ELA2base; E0055 grandmother
Relative ELA2base; E0056 aunt
Relative ELA2base; E0057 aunt
Relative ELA2base; E0058 mother
Relative ELA2base; E0060 sister
//
ID Intron 4(5i); standard; MUTATION;
Accession E0060
Systematic name g.IVS4+5G>A, c.597+5G>A, r.597+5g>a,
Original code Family 601;22
Description A point mutation in the intron 4 creates a putative
Description cryptic splice-donor site leading to aberrant splicing
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4720
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +5
Feature /note: putative deletion of the last 30 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 10 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XX
Family history Inherited
Relative ELA2base; E0052 grand-grandmother
Relative ELA2base; E0053 granduncle
Relative ELA2base; E0054 granduncle
Relative ELA2base; E0055 grandmother
Relative ELA2base; E0056 aunt
Relative ELA2base; E0057 aunt
Relative ELA2base; E0058 mother
Relative ELA2base; E0059 brother
//
ID Intron 4(6a); standard; MUTATION;
Accession E0061
Systematic name g.IVS4+5G>A, c.597+5G>A, r.597+5g>a,
Original code Family 604
Description A point mutation in the intron 4 creates a putative
Description cryptic splice-donor site leading to aberrant splicing
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4720
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +5
Feature /note: putative deletion of the last 30 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 10 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Not known
Relative ELA2base; E0062 daughter
Relative ELA2base; E0063 daughter
Relative ELA2base; E0064 son
Relative ELA2base; E0065 son
//
ID Intron 4(6b); standard; MUTATION;
Accession E0062
Systematic name g.IVS4+5G>A, c.597+5G>A, r.597+5g>a,
Original code Family 604;3
Description A point mutation in the intron 4 creates a putative
Description cryptic splice-donor site leading to aberrant splicing
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4720
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +5
Feature /note: putative deletion of the last 30 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 10 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0061 father
Relative ELA2base; E0063 sister
Relative ELA2base; E0064 brother
Relative ELA2base; E0065 brother
//
ID Intron 4(6c); standard; MUTATION;
Accession E0063
Systematic name g.IVS4+5G>A, c.597+5G>A, r.597+5g>a,
Original code Family 604
Description A point mutation in the intron 4 creates a putative
Description cryptic splice-donor site leading to aberrant splicing
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4720
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +5
Feature /note: putative deletion of the last 30 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 10 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0061 father
Relative ELA2base; E0062 sister
Relative ELA2base; E0064 brother
Relative ELA2base; E0065 brother
//
ID Intron 4(6d); standard; MUTATION;
Accession E0064
Systematic name g.IVS4+5G>A, c.597+5G>A, r.597+5g>a,
Original code Family 604
Description A point mutation in the intron 4 creates a putative
Description cryptic splice-donor site leading to aberrant splicing
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4720
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +5
Feature /note: putative deletion of the last 30 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 10 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0061 father
Relative ELA2base; E0062 sister
Relative ELA2base; E0063 sister
Relative ELA2base; E0065 brother
//
ID Intron 4(6e); standard; MUTATION;
Accession E0065
Systematic name g.IVS4+5G>A, c.597+5G>A, r.597+5g>a,
Original code Family 604
Description A point mutation in the intron 4 creates a putative
Description cryptic splice-donor site leading to aberrant splicing
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4720
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +5
Feature /note: putative deletion of the last 30 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 10 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0061 father
Relative ELA2base; E0062 sister
Relative ELA2base; E0063 sister
Relative ELA2base; E0064 brother
//
ID Intron 4(7a); standard; MUTATION;
Accession E0066
Systematic name g.IVS4+5G>A, c.597+5G>A, r.597+5g>a,
Original code Family 612
Description A point mutation in the intron 4 creates a putative
Description cryptic splice-donor site leading to aberrant splicing
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4720
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +5
Feature /note: putative deletion of the last 30 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 10 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Family history Not known
Relative ELA2base; E0067 son
//
ID Intron 4(7b); standard; MUTATION;
Accession E0067
Systematic name g.IVS4+5G>A, c.597+5G>A, r.597+5g>a,
Original code Family 612
Description A point mutation in the intron 4 creates a putative
Description cryptic splice-donor site leading to aberrant splicing
Date 09-Oct-2003 (Rel. 1, Created)
Date 09-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581030
RefAuthors Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A.
RefAuthors G., Dale, D. C.
RefTitle Mutations in ELA2, encoding neutrophil elastase, define a
RefTitle 21-day biological clock in cyclic haematopoiesis.
RefLoc Nat Genet 23:433-436 (1999)
RefNumber [2]
RefCrossRef PUBMED; 8989458
RefAuthors Palmer, S. E., Stephens, K., Dale, D. C.
RefTitle Genetics, phenotype, and natural history of autosomal
RefTitle dominant cyclic hematopoiesis.
RefLoc Am J Med Genet 66:413-422 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4720
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +5
Feature /note: putative deletion of the last 30 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 10 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Family history Inherited
Relative ELA2base; E0066 mother
//
ID Intron 4(8a); standard; MUTATION;
Accession E0068
Systematic name g.4676C>A, c.558C>A, r.558c>a, p.Val186Val
Original code Family 15
Description A point mutation in the exon 4 creates a putative cryptic
Description splice-donor site leading to aberrant splicing
Date 13-Oct-2003 (Rel. 1, Created)
Date 13-Oct-2003 (Rel. 1, Last updated, Version 1)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4676
Feature /change: c -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /note: putative deletion of the last 40 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 14 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Relative ELA2base; E0069 daughter
Relative ELA2base; E0070 son
//
ID Intron 4(8b); standard; MUTATION;
Accession E0069
Systematic name g.4676C>A, c.558C>A, r.558c>a, p.Val186Val
Original code Family 15
Description A point mutation in the exon 4 creates a putative cryptic
Description splice-donor site leading to aberrant splicing
Date 13-Oct-2003 (Rel. 1, Created)
Date 13-Oct-2003 (Rel. 1, Last updated, Version 1)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4676
Feature /change: c -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /note: putative deletion of the last 40 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 14 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XX
Ethnic origin Caucasoid
Relative ELA2base; E0068 mother
Relative ELA2base; E0070 brother
//
ID Intron 4(8c); standard; MUTATION;
Accession E0070
Systematic name g.4676C>A, c.558C>A, r.558c>a, p.Val186Val
Original code Family 15;5
Description A point mutation in the exon 4 creates a putative cryptic
Description splice-donor site leading to aberrant splicing
Date 13-Oct-2003 (Rel. 1, Created)
Date 13-Oct-2003 (Rel. 1, Last updated, Version 1)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4676
Feature /change: c -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /note: putative deletion of the last 40 nt of exon 4,
Feature /note: not confirmed experimentally
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Feature /note: putative deletion of the last 14 aa of exon 4,
Feature /note: not confirmed experimentally
Diagnosis Cyclic neutropenia
Sex XY
Ethnic origin Caucasoid
Relative ELA2base; E0068 mother
Relative ELA2base; E0069 sister
//
ID Intron 4(9); standard; MUTATION;
Accession E0087
Systematic name g.IVS4+1G>A, c.597+1G>A, r.597+1g>a,
Original code Patient 4
Description A point mutation in the intron 4 leading to an inframe
Description deletion of the last 10 residues from exon 4
Date 09-Jun-2004 (Rel. 1, Created)
Date 09-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11675333
RefAuthors Ancliff, P. J., Gale, R. E., Liesner, R., Hann, I. M.,
RefAuthors Linch, D. C.
RefTitle Mutations in the ELA2 gene encoding neutrophil elastase
RefTitle are present in most patients with sporadic severe
RefTitle congenital neutropenia but only in some patients with the
RefTitle familial form of the disease.
RefLoc Blood 98:2645-2650 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4716
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Diagnosis Congenital neutropenia
//
ID Intron 4(10); standard; MUTATION;
Accession E0089
Systematic name g.IVS4+1G>A, c.597+1G>A, r.597+1g>a,
Original code Subject 21
Description A point mutation in the intron 4 leading to an inframe
Description deletion of the last 10 residues from exon 4
Date 09-Jun-2004 (Rel. 1, Created)
Date 09-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4716
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Diagnosis Congenital neutropenia
Sex XX
//
ID Intron 4(11); standard; MUTATION;
Accession E0090
Systematic name g.IVS4+5G>A, c.597+5G>A, r.597+5g>a,
Original code Subject 22
Description A point mutation in the intron 4 leading to an inframe
Description deletion of the last 10 residues from exon 4
Date 09-Jun-2004 (Rel. 1, Created)
Date 09-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4720
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Diagnosis Congenital neutropenia
Sex XY
//
ID Intron 4(12); standard; MUTATION;
Accession E0091
Systematic name g.IVS4+1G>A, c.597+1G>A, r.597+1g>a,
Original code Subject 1 (Table 2)
Description A point mutation in the intron 4 leading to an inframe
Description deletion of the last 10 residues from exon 4
Date 09-Jun-2004 (Rel. 1, Created)
Date 09-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4716
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Diagnosis Cyclic neutropenia
Sex XY
//
ID Intron 4(13); standard; MUTATION;
Accession E0092
Systematic name g.IVS4+1G>A, c.597+1G>A, r.597+1g>a,
Original code Subject 2 (Table 2)
Description A point mutation in the intron 4 leading to an inframe
Description deletion of the last 10 residues from exon 4
Date 09-Jun-2004 (Rel. 1, Created)
Date 09-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4716
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Diagnosis Cyclic neutropenia
Sex XY
//
ID Intron 4(14); standard; MUTATION;
Accession E0094
Systematic name g.IVS4+1G>A, c.597+1G>A, r.597+1g>a,
Original code Subject 4 (Table 2)
Description A point mutation in the intron 4 leading to an inframe
Description deletion of the last 10 residues from exon 4
Date 10-Jun-2004 (Rel. 1, Created)
Date 10-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11001877
RefAuthors Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A.
RefAuthors G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis,
RefAuthors G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
RefTitle Mutations in the gene encoding neutrophil elastase in
RefTitle congenital and cyclic neutropenia.
RefLoc Blood 96:2317-2322 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4716
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Diagnosis Cyclic neutropenia
Sex XX
//
ID Intron 4(15); standard; MUTATION;
Accession E0123
Systematic name g.IVS4+1G>A, c.597+1G>A, r.597+1g>a,
Original code No. 30
Description A point mutation in the intron 4 leading to an inframe
Description deletion of the last 10 residues from exon 4
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4716
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0029: 606..635
Feature /change: -gtgaggggcc ggcaggccgg cgtctgtttc
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08246; ELNE_HUMAN: 190..199
Feature /change: -VRGRQAGVCF
Diagnosis Congenital neutropenia
Ethnic origin Caucasoid; France
//
ID Intron 4(16); standard; MUTATION;
Accession E0124
Systematic name g.IVS4+5G>A, c.597+5G>A, r.597+5g>a,
Original code No. 32
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 15-Jun-2004 (Rel. 1, Created)
Date 15-Jun-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14962902
RefAuthors Bellanne-Chantelot, C., Clauin, S., Leblanc, T.,
RefAuthors Cassinat, B., Rodrigues-Lima, F., Beaufils, S., Vaury,
RefAuthors C., Barkaoui, M., Fenneteau, O., Maier-Redelsperger, M.,
RefAuthors Chomienne, C., Donadieu, J.
RefTitle Mutations in the ELA2 gene correlate with more severe
RefTitle expression of neutropenia: a study of 81 patients from
RefTitle the french neutropenia register.
RefLoc Blood 103:4119-4125 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4720
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Congenital neutropenia
Ethnic origin Caucasoid; France
//
ID Intron 4(17); standard; MUTATION;
Accession E0131
Systematic name g.IVS4+1G>A, c.597+1G>A, r.597+1g>a,
Original code CyN 2
Description A point mutation in the intron 4 leading to an amino acid
Description change
Date 20-Oct-2005 (Rel. 1, Created)
Date 20-Oct-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16079102
RefAuthors Sera, Y., Kawaguchi, H., Nakamura, K., Sato, T., Habara,
RefAuthors M., Okada, S., Ishikawa, N., Kojima, S., Katoh, O.,
RefAuthors Kobayashi, M.
RefTitle A comparison of the defective granulopoiesis in childhood
RefTitle cyclic neutropenia and in severe congenital neutropenia.
RefLoc Haematologica 90:1032-1041 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0029: 4716
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Cyclic neutropenia
Sex XX
//
//
|
